GenePrediction:GLEAN_535 Details

Name: GLEAN_535
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:455967..459562 (+ strand)
Length: 3596
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:455967..459107 (+ strand)
Length: 3141
Type: CDS
Source: GLEAN
Position: GCSC_97:459242..459562 (+ strand)
Length: 321
>GLEAN_535 class=GenePrediction position=GCSC_97:455967..459562 (+ strand)
ATGTCGCTCTTCGGAAACACTGCGAGGGCACCGACAGCCTCCCCTTTTGGCGCCTCTTTGTCGGGCTCGACAGCCTTGTC
GTCGAACGCTCAGGCTCCAGCAGGATCAGGAGCTCGGCCGTCTGTGTTTGGCTCCAGCCTCTGGGACACGTCCGCGAGTG
GTATCAACGCCGCGCGTCCGGCTGGAAACCCTCTCTTTGGCGTCGGAGGTACCGGAGCGGGCACTGCCACTTTGACTGGC
AGCACCACGGCGCCCAACTTCCAGTCGTCCACGTTCAATGCATCGACAGCGACGGTGCGGCCTGCCGGCACCGGGGCATA
CTTTGACAGCCTGTTGGCCAAGAGCAGGATGCGATCAGAGTCGGGCGAGGGTGGGGCGGGCAGCGGCAGCGGTGGTCTTG
GGGCGGCCGCTGGCAGTGCAGACCTGCCCAGCCTGCACCTCGGCCTGGGCGACCTGCGTCAGAAGCTGCGCAAGCTGGGA
CCGCGGGGTGCTGGGATGGGTGAGAGCATCGGTGGCAGCGGGGCAGCCGGTGGGCCTGGCACCTCTCTCTACGACGGCAA
GGCACACTACATCCTGGCGGCATCGGGCGTGGACCCGGGGGCGGCCGTGCGGGACCTGGGCAACCTCAGCATCTACGCGT
CGACACGGCCGACGGCGGGTGCGGGTGCCAGCTTTGGGCCCGGTGGAGCGGTGGCTGCTGGTGGCGGCGGCACGACGGCA
GAGGTGGACGTGGACACGTATCTGGCCAACCTGCAGACCAAGACGACGCTCAGCATGATCAACGACGGGCTCGAGCGGTC
AGTGCGCGACTTTGACAGCTTCCTGGAGGACAATGTGACGATGGAGTGGGAGGCGCAGCGCAAGCGGATCTACGAGCACT
TTGGGATCAAGACGCGCGATGAGCTGGCCGGAGCGGGTGGCGCGTCACGATACGGCGACACGATGGGCGGGGCTGGAGGC
GGAGGTGCCGGGGGTGGCGGGTTCGGGCGGTCGCGTCGCCGGCAACAGCAACAGCAGCAGCAGCAGCAGAACAACTCGCA
GACGCCGGGGCCCAAGGCGGGTGGCAGCGTGTTTGGGCGGTCGCGCATGCAGAAGTCGGTGATCGGGTCAGCCAGCCGGA
TCGGGTCGCATGCGTCGGAGTTCACGGACGTGGAGACGGCAGGCGGCAGCAGCAGCGGTGGCAGCGGCAGCGCGGCGTCG
GTGGATGATCGGTACACGCGCGAGAAGCAGGGGCGGCTAGCAGAGACGATCCACCGGCTCAACGACTGCCGGATCGCGTC
GGCGCCGTTCCCGATCCTCAGCGAGATGGTGGCGGTGGAAGACGGGCTGGGCGGCGACCGACACCATGCGCTGGTCAGCG
ACGCATTCCGGGCGCTGGCCGGGATCGTGGGTGAGGACGCAGACTCAGTGCACCAGGCACACCACACGCGGGGCGAACCG
GGGCCGCGGCAGCGGGCGTTTGCGCGAGCATACCTTGACCCCAACCCGAGCAGCGCCGGGGCGATCTCGGTGCGGCAGCA
GATTCTGAACGGGGCAAACCGGTTCCTGGAGCGACGATTCTTCGCCGAGGTAGAGGCACAGATCGCCAAGTTTCCGCAGG
AGGCCAGCCTGGGCGGGCGGCCGGACGTGGTCAGCAAGATCAAGGCGTATATCCGGGTGCGGGCAGCGCAGAAGATGCTG
GTGCCAGACAACGTGGATCTGCAGCAGGTACAGGGTGAATATGTGTGGGCGGTGATATTTTATCTGCTGCGGTCGGGCCA
CGTGACAGAGGCGGCGCAGTACGTCAACGACAACCAGACGCAGATCCGCGGGATCGACCGGGTGTTTGCGAGCTACATCA
ACAGCTACGCGACGAGCGACGACCGACGGCTGAAGCGGGCGATGCAGGAGCGGTGCAGCAGCGACTACACGCAGCGGGCA
CGCAACGCACCAGAGGGCTCGGTGGACCCATTCCGGATGGCATGCTACAAGGTGATCGGGCGGTGCGATGTGGGCAACCG
GAGCCTGGACAACCTGCAGACGGACGTGCACGACTGGATATGGCTGCAGTTCAACCTGGCGCGCGAAGGTGACCGGGCCG
CAGAGCTGGCGAGCGAGATGTACGGACTGGCAGAGCTGCAGGAGACGGTGCGGGACATTGGGCAGAAGCACTTTGCCAAG
AACGCGGCGGGCGTGGCGGACGGGTCGTTTGCCATGTTTTTCTATCTGCAGGTGTTGGCGGGGCTATTTGAGCCGGCGAT
TGCGTACCTGTACTCGTTTGCGTATGTGGACGCGGTGCACTTTGCCATTGCGCTGGAGTACTACGGACTTCTACGGACGC
CGGACGCGAGTCTGGCAGCGGCGAACGAGCTGCTGAGCCACAACACGCGCGGGCTGCCGCAGATCAACTTTGCCCGCATG
ATCGGCTATTACACGCGCGATTTCCGGGCGGCCAACGTGGCGGCTGCGGTGGACTATCTGGTGCTGATCTGTCTGGGGGA
TGACGGAGAGCAACAGGTACAGGCGCAGACGCAGGCCACGGCCGGGGCCAAGGAGCAGACGGCAGCCGCGGTGCTGTGCT
ACGAGGCGCTGCGCGAGCTGGTGCTGGAGACGCGCGAGTTCAGCAAGCTGATCGGCGACATTCGGCCGGACGGCACGCGG
ATTCGTGGTCTGGTCGAGGAGCGTGGTGGGCTGATCGCATTGGACCGCGAGCAGGACTTTGTCCGGGCGATCACGCTGCA
GGCGGCACGTGACGCGGATGACGGTGGGCGGACGACAGACGCCGTGCTGCTGTATCACCTGGCGGGCGACTACGACACGG
TGGTGGTGATTGTGAGCCGGGCGCTGAGCGAGGCGATCGCGCTGGAGATTGGCGAGGAGCCCATGCGTCTGGTGCCGGTG
AAGCCGCGGGTGGAAGGCAACGGCAACGGCAACGGAAACGGAGACGCGAGCGTGTCGACGGCGCGGTCAGGCAGCAGCCT
CAGCCTGGCAGCCATTGACGATCCGGTGGAGCTGGCACAGACGATGATGACCATGTACGAGCGCGACAACATGTTCCGGC
GGCGGATCCGGGAGGAGAACCGGATTGCGTGCAGCGTGCTGCTGCAGATGAGCGAGATTAAGGGATTGGTGGAGGCTCGC
AAATGGCCACAGTGTCTGGATGTGAGTTTGGGATTTTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC
TTTCTTTCTTTCTTCCTTTCTTCCTATCTCATTTCTTTCTTCTCCCCTCTTCATCCCCCCCACTAACCAAAACAGAGAAT
TCGCGACCTCGAGATCCTGCCGCTGCAGGCCGGCGGCGACCCCAGCATGATCCGCAGCTTTGCAGCACGGTTCCCCGGCT
TGGCGCAGCCGGTGGCCATCAACGTGCCGAACCTGCTGATGTGGACGATCCTCTGCTGCACGCAGCAGCGCGGACGCCTG
CTGAGCGGCCAGTTCAGCGGCAACGAGTCAGCGTCGCGCATGCTGGCCGACGAGCTCAAGCAGATCTGCGTCGACCTGAC
CGCCTACACGAGCCAGCTGCGGTACCGCTTCCCGCCATACCTGCACGAGGCGCTGGCACGGGCATCGGCTGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62