GenePrediction:GLEAN_5362 Details

Name: GLEAN_5362
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:158219..155061 (- strand)
Length: 3159
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:158219..155687 (- strand)
Length: 2533
Type: CDS
Source: GLEAN
Position: GCSC_97:155623..155061 (- strand)
Length: 563
>GLEAN_5362 class=GenePrediction position=GCSC_97:158219..155061 (- strand)
ATGGAAACATTACGGCTCAAACCACGGCAACCGGTCGAGGATGTGGTGGAAAACTGGGACGATGACGATTTCATGATTGA
TGGCGATGATATCACATTTCGGAGCGGCTCGACAGCTGCACAAAATACAGGCAGCCGCCGTGACTCGCTCTCTTCTTTCC
GCTCTGATTTTGAGTCTATTCATGCCGAGGATGAGCAGCAGGTACTCGTTCCAGGGGACGACGAAAAGTCCACGTCAGAT
GCCATTGCTTTGGCCGCCAGTGCAGGCATTCCTCTGCCCACAAACGTCCCACCATCAGCCCTGATGGGTGGCACTATCAA
AAGGCTAGGGGGCCAAAAAATCAGAAAGATCTTTGAGGAAGATTGGGGAGACGATCTGGAACTACCAGATGACCCACAAC
CGCTTCGAGTGAAGCCACAAGACGGCTCCAATTTTCCCGATGCACTTCAGCAAGTCGGTGGCAGCTCTAGCCCGACAAGC
CCGACGAGATCAACCAAGGCTGTTTCCATGGAGGGCCTTCTTCACCAAGAGCCAGTTGTTGTCGCTAGAAGGCAGTCGGA
TGCCCAACTTGGTTCTGTCAACCTAGACATCTTCCGCGACACGGACGACGAGGATGACTTTTTTGACGGTGGTTCCACCA
TCAGAGTGTCCAAGCATCGACAGATACCAAAGCCGATATCATTGATCACACCGCCCACACCCCAGAGGAACGATGCGGCC
GATGACGATTTCGAACACGATCTCGAGTTGCCATCCGACGGTAAGCTCACGCTGACCAAGCGCAAAGACATTCCCAGAAC
GCCTCTCCTCAGCACATTGGATGAGTTTGAATGGGGCGAAGGCAGTCTGGGCACCCGGCACGGTGGCACCCGTCGCGATG
GGCTCTCCAACCGCAGCTCCTCTGTGTCTGCCCTGAGCCCGAGCGTGTCAAGCTCTATCACGGCCGAGAGCGAAGGCGAG
GACGACACGTTTGACGGCATTGTACTTCCTACCGGCACAGTCGACTTTGAAGAGAGACTGAAGAAGAGACGCACCAGCCG
GTCGCCGCACCGGCCAACACAGTCAGAGGATATCCATGCAACCCAGACCAAGGGGCAGTGGCAACCCTCAGCGCAAGCAC
AGCAAAAGCAGCCGCAGCAAGCAGCAACAACGGGCCCGACACAAGGATTTTACACCAAGCACCACCAGCAGCATCAATCG
CTTCCGGAGGAAGACGTGCTGGATGGTTTTGATCTTGGTGACCGCGATGTGTTTGATGCCAATCGATTGACATATCACCG
CAATGTCCGCATCAAGTCTGCTCGGGCGACAAGCCCGGTCCGTCCGAAGGCTGCGGTTTCCATCACGTTCAAGCAAACCC
CGTCACTGTCTCGGTTGCCCAGGCCTATGAGTGGCCATGAACGGACACAAACGGCACCATCCTTGGAGCCCGTGTCGGAA
AGCGGCGGTCCGATCTACAACATGGCACGGCGTTCTCAGTCGCGTGCCGGGCATTCAGCCCAGTCATCCTTGTCCAGCAT
CCCTACCCCCACGACTCCGTCTACGGCCCAGTCCATGCCACCGCCCTCGACTCCTCGTCGGAGAGAAGCAGGCAACCACA
AGATGTCGGCCGTCTCCTTGCGGAATGAGCCCACGACAACCAATGCTCAACTTCTACGCCTGAAGCGGTCACTGCCGGCC
ATCCGACAGCTCCCGCCCGCTACACGACCAGTAACCCGAGGATATGATCGGCCACCCTCAAGGTCTGAGTCGGGCAGCCG
TGGGCAGTTGCCTGCAAGGCCGAAGACTCCTGTCGAGAGGACGCGTGTTGGCCAGGAGAGTGCCACAGCGCAGGCGAGGA
AGAACCCACTGCCGTTTCTGCCAGCCGGGGCCTCTCAGTCGCAGTCTCATCACGTCACTGCGAAGAACTCGCGCGTATTT
CGCCGTCAGGATTCGGAACCATCGATTGAGATCCCTCCTAGCTCGCGAGCGGTGTCCCGGTCGACGATGCGTTCCCCAAG
TCCGGCAAGGCGGCACCGTTATACCGTGGACAAGATCACACAGGACAGGTCGTGGCAGCAGCTTAGCAAGCCTCGGCGAA
TGCGGCAGTTTGGCGACGGCCATGAACTGGACGGTTTCGATGACTTGCCGACGTCGGTACAGGTGGAGGAAACGTTTCTG
CGGCAGCCGATGTCGTCCTTGTCGGCGAAGTCGCAGCTGCGCAGCAAGATGTACCAAAATATTCTTCCGGATCGCACCGT
CACGCCATCGCCGTCGGGGCTGTGTTCGGCGGCCAGACTCGATAATTTGCCGCATTTTGCACGCGACACGGCGGCGAGCC
GGATCGCTCGAGAGACGTCTCTTGCTCAACGCACGCCATCCGGGCCGTTGGCGCCGCTGACGGCGCAGAGAGTGGCTCAG
CTGTCAACACGCAGCAACTATGGCGCTCCAGCTATTCCGCGCGACACGGTGCGGTCCAAGAAGTCGACACGCCGACCGCC
GCAGCTGAAGCCTCACCTGATCTCCAACCTAGGTGGGGGGAAGGAGTCGAAGAGTAAGCAATTGCGGTGTGCCTCGTATC
TCTTGAAGAATGTCCGATGCTAACGTACATGTACAGCGGTCAACGGGATGTACTACAACCCGGCTAACATGCGGTGGGAG
GGCAATGAGAATGCGCTTACGGATTTCGATCCGCCGGCATCATCGCCGTCTACGGCGTCTATTGCTCCGTACCTGCACCG
GGAGAGGGAGAGCGCGACACCCCGACCTGCGCTTATCACGCCTATCGGGGCTACAAAAGGGGTGCAAGTGGTTGGAGGGA
TGGTTTTCGACCCGCAGAACATGTGCTGGCTGAAGTTGGGGCCGCAGAACGCCAAGGCAGAGGCCGATGACGTGATGGAT
GGGTTCAACGGCATCGATAGCGACGAAGACGTTTTCAAAGACATCCCGGACCTGGAGGACATGGCAGACACGACAGAAGC
AGGCGGTGGACGTTCGAGCGAAATTAAGGATGACTGGCTCGTGGGAGAAGAGTTCGACGTGGGCCCCGAGTTTGTCCGGC
GCCAGCGGGAGGAAGAACAACGGTGGAGGAAGAAGTGCGAGAGATGGATGACCTTGGAAGAGCGGGACCAGAGCACATGG
CGCTGGCTTCTCCGCGAGATGGTGACTCATCCGATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62