GenePrediction:GLEAN_5363 Details

Name: GLEAN_5363
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:151873..151093 (- strand)
Length: 781
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:151873..151763 (- strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_97:151677..151093 (- strand)
Length: 585
>GLEAN_5363 class=GenePrediction position=GCSC_97:151873..151093 (- strand)
ATGTCCGAACTACAGTTTGTTCGCTCGTTTCTGGGCTCCCTCGACGGCTTGCCGTTGAAGCTGTCGGCCGACTACATGGA
GGATGCAAAGGGCTACCCAGCCCGGCCACCAGTCAGTTCTTCCTCTCCCCTCCTCCTCTCCTCTCCTCTTTCCCCCCTCC
TCTCTCCTCCTCTCTCCCCCCCACTAACTCCCCCAGTACATCCTCCCCCGCATGGCCAAGCCGATGAAGAAGACGTCCGA
GACCCGACTTCCGCCCGGCCAGGAGCGCTGCGTCGTCGTCTCCGTCAAGTCGCTGCACCGCAGCCCGCCCCTCGACCTGC
AGCTCGGCGCCCTGCCACTCGCCACCACATCGCTGCTCGACCTGCGCCAACAGCTAGCCACCAAGACGCACGTGCCCATC
GCCAAGCTGAAGCTGCTGTTTGGCAAGAAGCCTGTCGCCGACACAAAGGTGCTCAAGGACCTGATCGGCCCCGCGGCCAG
CGCCTCGGCCACGACACTCGAGCTCGGCCTCATGGTCGTCGGTGGTGCTGCCACCGTTGCCGCTGCCACCCAGGAAGCCG
AAGAGGAGACAAAGACTGCTGCACCGCCGCCCGCAGCTGCACCACCACCCGTGGCCGTCGCTGCGGCTGCTCCGCCCCCT
TCTGGCCAGGCCGTCGTCGAAAGCGAGGCCTTCTGGTCTGACTTGCGCGCATTTTTGGTCGCCCGCATCAACGACGACAA
GCTGGCCGATGAGCTCTTCAGCTCCTTCTTGCGCGCCTGGGACGAGAGACCGTCCGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62