GenePrediction:GLEAN_5365 Details

Name: GLEAN_5365
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:129162..128604 (- strand)
Length: 559
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:129162..128977 (- strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_97:128891..128604 (- strand)
Length: 288
>GLEAN_5365 class=GenePrediction position=GCSC_97:129162..128604 (- strand)
ATGGCCGAAGAACCCAACGTGGAGAACAATGCCCGGGGACCTTCCCCCGAATTTACATTCCCAGAGCCCAACCCACAGGA
GGCCATGCTCTTTTTCAACATTATCAAGAATGTCTCCAACCTGCCCGATATCAACTGGGATAACGTTGCCACTGACTCTG
GATTCAAGAATGCTGCTGTTGCAAAGGTTGGTTTTCCTTCTTGCCTACAACCTACAATTCATGAACTCCTCTCTCGCTCG
GACCAACGTCTCATATTTTCTTTGCTTTTAGAAGCGATTCTACCAGATCAAGCAGAAGCTTGGACTCGATAACAACAACC
TATCCGGGTGTTCTACAAGCAAACCTGGTCGCAAACCCAAAGCCACGGGAAGTACATTCACATCTGAGGCCGCCCAAGGG
GCCGCCACGAGTGATACTATTCGGAAGCCTGTGGCCTCGCCCAAAGTGACCAAACGCCGGAAGGCTGTAAAGACAGAGAA
ACAAGGAACCGCACATGCTCCGAAGGACGGCTATTCTCCCACAAAAACCGGCGTCAAGACTGAAGACGCGAATTTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62