GenePrediction:GLEAN_5368 Details

Name: GLEAN_5368
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:118447..115909 (- strand)
Length: 2539
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:118447..117906 (- strand)
Length: 542
Type: CDS
Source: GLEAN
Position: GCSC_97:117835..115909 (- strand)
Length: 1927
>GLEAN_5368 class=GenePrediction position=GCSC_97:118447..115909 (- strand)
ATGGATGTTGCCGCGAAACAGATCGCCCAGCTTGTCCAGCGCGTCCTGCCCGAAAGACCACACCATCTCTCCATCTCACC
GGACATCCGCTACCTAGTGCCTTCCGACCACCTCTGGCCCAAAGACTCTCCGCTGCAGTTCACGACATATGTGTCCGAGG
CCGATCGCGGCGTCCTCCTGACACGTCCTTTCTACGACATACAGCTGCAACCGGACGAAGACACGAGCCGAATCGGCAAA
AACGCTGGCAACGGGAACGGCAACAACAAGAAGAGCAAGCCATCATCCAGCCTCAACTCTTCGTCTGCAACCTCCCCGCT
TGCGGACGTCAACAGCAAGGGTGAGACGAAGAAGAAGGTATCTTTGAAGGATTACCAGAACAAGCTGCAGAAAAAGCTGC
CGGGCTCGCCGCCAGACTCAGCTCCGGATTCGGGTTCCAAGGCTGCAAAGCTAGATACGGGCCGTAGCAGAAGTACAAGC
ACAATGGCCTCGCTACCGGCCGGCCACCGCCTCCCCCCAAAACCCGATGTGAATGGCGACAGGTCCGTCTTCTTCCTCTT
CTCCTCAGCTCTCTACCTGTCTGGGCCGTGCCGCGTTTGCTAACATGCTCAGAAAATACAACCACTCGCCATCTAAATCG
CCAAAACCACTCCAGAGCTCGGGCGTATCCGACAGCCGAAAACGGCCTGCAGACACACATGAAACGAGCCGTCCGCACAA
GCGGTCGAGATCTGACACATCCATGAGCTCCGACTCACCGCCAGCACCGTCTCGGTTCAACCAACGACCGCATAACCCCC
CCAGTCCTCTGGACCTCAACAACCGGAAGGAAGATCGGAAGCGAACAACGGCAAACGGACAGTCACAGCATCGATCGCGG
GATAGCTCGAATAATCACGCAGCTCTGCCAGCCTCGAGAGCGAACGGACATCACCCTCAACGCACAGATGATGAACGGGA
ACGGACACCCGAGAACGATGTCATTAACGCCCCGGGTTCCGTACCTTCGTTGCCTCCTATTCTCTCCCCCCTCCACTTCA
ATCCTGAACGCGATCGCGAATCCTCGGTGAAACGGTCACGGCCTACTGCAGCTCCGTTGTCCAAATCGGCTTCAAAGACG
AAGTCTGGCAAGCCAGACGCGCTTCCGCCGTTGCTCTCGCCAACTCTACCTCCTATAGTAGAGCAAGAGCTGCTGCGTCT
TAGCAAGCCCACGATAAACTTGACGGCGGCACCCAGAAGCAACCAAGAGCTCCCTGTGTCGAGCAGTAGTGGCAAGAAAC
CCGCTCGTCCGGCACCGGATAGGGAAAAGGATGAGGAGCACAAAGAGATTCAGGCATACAGAGAGCCGCAGAGGGAACCG
CAACGTGAGCTATTACGAGAACCACAAAGGGAGTCGCATCGGGAGTCGCAGCGTGAACCTCCACGTGAACTTTCTCGGGA
AGCTCAAAGGGAACCGCAAAGGGAACTGCAAAAAGAGCCACCAGCACAGAAACGGACCTGCATCGTAACTCTGAAATACA
AAAAGAAGAACGCAAAAAGAGTACGGCACCTTCTCGCTCTCCAGCCAACGCCCATGAAAGCACCATCCAAGCGAACCGAA
CGCTCGCTCAGCGTTGAGGACACCTTACCGCCAGCGCCCATCACGAAGAAACGACCAGTGCAGTCAGACAATCTCGCCGG
GGACCCGTCGCCATCCGTATCGTTCAAGCACCCAAGGACAGTTGCAGAAAAGAGCATATCGGCAGCGAGGGCACCAGCTG
CCCCTGCCACACCACTGAAAGCCACCCCTATGGTCCGCGTCACGTCAAACAACTCTCAAGTTCTCACACCCAACGAGTCG
GCCAGCTACACTCCACGGTCCGCCGAACGGCCGCTTACAAGTCAAGGCGACCCGGCATCTGCAGCTGCAGTGTCAAAGTA
CCGGCGCCGCTACGATGCCTACCTGACGTTGGGGACAAAGCTCAAGCACGATCGAGACGCCATTGTTAAGAACCGGCTAC
CCAACGGAACCACAAAGCTGGCCGACGGGGTGGCAGCACCGGCGCCAAACCTGCTGCCGTCCGAAAAGAGGCTTGTCGCT
GCTCTCAGCCTTGAAATGGTCATGTCGTACATGATAGCATTCAAGGCGTTCAACCAGTCCCGACACCTGGAGCGAAGGGG
GAGCGACATCACCGTTTGGGAACGGCTGATGCCGCACCTGGCAGAGCTGCGAAGCCACGCACGGCAATTCCGGCCCATCG
AAGCCCTGGCACTGCAGCTTCGTGCCATCTTCTTTGAGCAAATGCTCGTCGCAATCACCAGCCACGAGGCCCAGTCGGTC
GCCGGAAAGCTCCTAAAGGCCACCAAGCTCCGTCTCGAGGCCTGGACAGATGCACAAAATAGTGTGGATCTGGTCAGTGA
CGAGTCGATGAGAGTTGTTGTAGGGCCATGGCTCGGGGTTGAGGACACGGTGCGGGCCATGTTGCCCGTTCTACGTCGGT
GGTGCGATAAGGAAAATGTGGCCTGGGAGCAAGAGCTACAGCTTCCGGACAGCCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62