GenePrediction:GLEAN_5369 Details

Name: GLEAN_5369
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:104536..102602 (- strand)
Length: 1935
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:104536..102602 (- strand)
Length: 1935
>GLEAN_5369 class=GenePrediction position=GCSC_97:104536..102602 (- strand)
ATGGCGACGCCTAAACCGACGAAGAACCAGCTGCGGCGAGCGAAGAAGAAGGAGGAAAAGAAGTCACAGAAAGCAGAGGT
GAGTCAGTACCAGGGCTTGGATGATGCGCGTGCAGGTGCTCACGTACAGCAGACTGTCGAAGAGCCAAAGGCCGAAGCGA
GCATCAGAGATGACAAGGCCGAGAGCAAGGACGAAAGCGCGCCAGTTGTTGAGGCCGCGGTGAAAGGCGAGACGGCCATT
GGCGAGGACAAGAAGGAGGCCGGTGCAGATGCAGCGGAACATGTGCAGACACTGGCCAGCATAGACTACGACGACCCGGC
GTTTTCGCAGTTTAAGGACATCTTCAACAAGTTCGGACCGGACCTGGAAGGCGACGATGTGGCCCGAGAAGCCAACGCGG
GCAACCAGGGAGAGGTGCTCATGGCGGAAGACGGAGTTCCAGAGGAGGAGCAAGAGGATGGGCCGGCCAAGATGTCGAAG
AAGAAGCGGAAGAAGCTCAACACGCTATCGATTGCGCAGCTGAAGGCGTCGGTGAGCAATCCGGAGGTGGTAGAATGGCA
CGACGTCTCGTCCTCGGACCCTCGGCTTCTGGTGGTGATCAAGGCGCAGAAGAACATTGTTCCGGTTCCGGGACACTGGT
CGCTGAAGCGGGAATACCTGTCGAGCAAGCGCGGTATTGAGAAGCCGGCGTTCCGGCTGCCGGCATTCATATCGGAGACG
GGCATCACGGAAATGCGCGACGCGGTGTTGGAGAAGCAGGCGGAGCAGACGCTGAAGCAGAAGCAGCGCGAGAGGGTGCA
GCCGAAGATGGGCAAGCTGGACATCGACTACCAGAAGCTGTACGATGCATTTTTCCGGTTCCAGACGAAGCCATCGCTGA
CGCGATTTGGCGACGTGTATTACGAGGGCAAGGAGTGGGAGGCGGAGTTCCGCAACTTCAAGCCAGGCGAGATCAGCGAG
AGCCTGCAGGAGGCGCTCAACATGCCGCCGGGGTTCCCGCCGCCATGGCTGCTGCAGCAACAGCGCATGGGACCGCCGCC
GTCGTATCCGAACCTCAAGATCCCGGGACTAAACGCGCTGCTTCCGCCAGGAGCGTCGTGGGGCTTCCAGGCCGGGCAAT
GGGGCAAGCCGCCAGTAGACGAGTACAACCGGCCGCTGTACGGTGGCGACATCTTTGGGGTGCCGGGGGCGAGCGAAGCG
GGCGGCGAGGTGGACGGGGCGCAGCGGACGCAGGGCGAGCCGATCGAGCGGGCGATCTGGGGCGAGCTGCAGCCGCCGGA
AGAGGACGAGGAGGAAGAGGAGGAAGAGGACGAGGAAGACGAGGACGAAGACGAGGACGTGGCAGACGGGCTGCAGACGC
CTTCAGGACTGGAGACTCCGAGCGGATTTGTCAGCTCGGTGCCGACAGATTATCCGGCAGGGCCGCTGGGAGTAGAGTCC
AGCATGGCGGGCGAGCTGGATCTGCGTAAGCAGCGGCGGGGATACGAGACGGAGGACTCGGTAGCAGGGCCACGGTCGGC
ATACACGGTGATCCCGGAGCGGCAGGCGCAGGCGCAGGGTTTCTTTGGCAGCGACCGGACGTACGACCTAAAGGGAGGCC
GTGCGGCGGCGACAGCGGCAGCAGCAGCAGCTGGGGCACCGGTTTTGGGTCAGGACGACGACGCGGGCCGCAAACGCAAG
AAGCCCGGCGACGTGGACGTGGCGCTGGACCCGGACGCGCTGCTGAGCCACGACGGGATCAGCAAGGACGAGCTGCAGCG
GCGGTTCGAGGAGGGGCGACAGGACGAGGGCGTGGGGGCGCAGTGGAAGAAGCAGCAGTACGACGACGACCTGAGCGAGA
TGATTGCGCAGGAGAGTCGGAAGCGGCAGAAGCGGGAAGAGGAGCGGCGGGGCGGCGTGGCCGAGAAGAAGAAGGAGGCC
AAGTACCGGTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62