GenePrediction:GLEAN_5370 Details

Name: GLEAN_5370
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:93380..91488 (- strand)
Length: 1893
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:93380..92912 (- strand)
Length: 469
Type: CDS
Source: GLEAN
Position: GCSC_97:92847..92667 (- strand)
Length: 181
Type: CDS
Source: GLEAN
Position: GCSC_97:92598..91488 (- strand)
Length: 1111
>GLEAN_5370 class=GenePrediction position=GCSC_97:93380..91488 (- strand)
ATGCCGACCATTTCGAGACTGCGGTCCGCGGCCCTTCTCGGGGCCTCTGTCAAATCGTCTGCCACGTCTTCGTCCTTCAG
GCCTTCCGTCCTCCATCACCGCCGATTCTCTGATTCACCGGCCTCGCCAGTAGCTCCTCGCAGAACACCAGGCCTCAACT
TGGGGTTTTCCAGCACATACGACCCATCCGAAGATGTTGTACGGGGTCCTATATTCGATAAGCCGAGGTTTGGTAGTGTG
CCTCAATTTTATCCGCGCGATCTAAAGAAGCTACTTGATACCTATGTTATTGGTCAAGAGAGGGCTAAGAGGACGACAAC
TTCCACGGTCTTTAACCACCACCAACGAATGCATCACAAGCTGCGTCAAGAAGAAACAGACCGCTTAACAAGGGAGAAGC
TGCAACGGCAGAGGTTTGCTAGAGACAGGGATTTGCATGACATACACCGGGAATCGCACAATTCCAACGGTCAGTGACTC
GACTGCTCACCGTTCTCTGAGCCAGCTTATTTTATGCCTAACTATTACCACAGATGCATACGAGCTTGACGAACGATTCG
AGCTGCCCGAAGGAGGGTATCGAAACTACAAACCCGAGCCTGTCGGTGGATTGCATATACCAGAAGGCCCAACACGTGCT
GAGGATGTCAGAATCGATAAGAGCAACTTGCTACTTATAGGCCCTACAGGTGTGGGCAAGACATATATACTCGAGTAAGC
GGGAAGCCTTTTTCCTCCCCCTACTTTGTGGTGACCCATGTCAATCTCATCTCGGCTCTTAGAACACTTAGCAAGGTCTT
AAACATCCCATTTGCCATATGTGATTGCAGCAGTTTCACGCAGGCCGGTTATGTCGGGAAGGACGTGGAGACGTGCATTG
AGAGACTTCTCATCGAGGCAAATTACGATACGCGGGCAGCCGAGTTTGGCATCGTGATTCTCGACGAATTTGACAAGATC
GCAAGGAAGGAGGAGGCGAACAACAGGGACATCGGCGGTGAGGGTGTGCAGCAAGCCCTCTTGAAGCTCGTTGAGGGGAC
GAAGGTCACGGTCAGCATCAAGGACAACCATTCCTCGCGTTCGGCCAGTCCCATCACCAGTACATATGGATCCCCAAATG
CCTCATTGCCGCCACAAGGCTCATCCGCATCTGGCAAAATTGAGCAGTACACAATCGATACCAGCCGCATCCTGTTTGTT
TTCTCGGGTGCTTTCGTGGGTCTTGACAAACACATCATCCGAAGGGTCGCAAAGCCGTCTTTGGGGTTTGGGTCCGAGCT
CCGAAGCACAAAAGACTCTACTATTGCAGGGAGCAAGGCTGTTTTACCTGCGAAGATGTATGCTCACCTACCACACCAGC
CTGCCGACGACGACCCGAATGGTGCAAACTTCACACCCCTAGACCTTGTCAGCCCGGCTGATCTCCAGGCCTTTGGGTTC
ATCCCAGAACTCATTGGCCGTCTGCACAACATATGCGCGTTGACACCACTGTCGGTGGACGAGCTATACCGTATATTGAC
GGAACCGAGGCACAGCCTCATCGCCCAGTACACGGCACTGTTCGAGACATATCCAAGCAGGCTATATTTCACCCAGAGAG
CCCTCCACGCTATTGCCGAGCGGGCCTCAAAGGTTGACACCGGCGCCCGAGGCCTAAAGATGGAACTCGAGCGGGTGCTG
GCAGAGCCTATGTTTGATGCTCCCATGGCATACGTCCTGATCACAGAGGGCTGCGTGAACGGCACGGACAAAGCTGGATA
TTGGGGGAAAGACGGGCTGTTCGAGGTTCAAAGACGTATTCGAGATGAAGACGAGGGTCTTGGCCGGGACGCAGCTGTTT
TGACGGAACTACCGCACGAGCAACCACGACAGGCCGGACAGAGCGGCGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62