GenePrediction:GLEAN_5371 Details

Name: GLEAN_5371
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:88921..77405 (- strand)
Length: 11517
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:88921..82298 (- strand)
Length: 6624
Type: CDS
Source: GLEAN
Position: GCSC_97:81121..80937 (- strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_97:80403..79648 (- strand)
Length: 756
Type: CDS
Source: GLEAN
Position: GCSC_97:79565..79123 (- strand)
Length: 443
Type: CDS
Source: GLEAN
Position: GCSC_97:79062..77405 (- strand)
Length: 1658
>GLEAN_5371 class=GenePrediction position=GCSC_97:88921..77405 (- strand)
ATGGGGAATTGGAAGGTGTTGGGCGAAGTCCCAGATTCGGATGACGAGGCTCTCTACAGCCATGAGTCTCGAGCGGAAAG
TCAAACCAGAGACGAATCAGTAACTGGTCTGGCAGGTCAAGATGAGCCTGGGGAATCGGCAGACGACATACGGAGGGTGC
CACATCCATCGCCACACAAGAACGACCACCACACTCTGACGTCTGTTTCTCCACCCTGCCAGCCAGCGGAGGCAGATCGA
GAACTACCCATCCCGACGACTCTCCCATCGTTTGAGGCTCTTGACGTCGATTCGGATGACGAAGTAGACATTATCTGCGA
GGATGTCCCTGATATCGCAGCTTTGGAGAGCAGCCCATTTCCAGCCACACCCAGGGCTGTACGCATCCAACGCTCCCAAC
AATCTCCGGCAGATCGGACAGTAGAGCCGGTGACTGCTTTACTGCAACCTCCTTCTTCACCACTGAGTTCCTTGTCCAGC
GTGTCTAGCTTGTCAGATTTGGCCTCTCCGCCTCCCAAATTACCGACTGCAGACCATATTCGCGAGAGTAGCCCAAGCCC
GCTGCCTTTGCTTCCAGACTCGCCTCCTATATTTCGCCTTGGCTTCGTTAGATCGCTACGCCGACGGAAACCTATTCAGG
AGCATCCCTACCTTTTGGAAGATGCTCGGTACGCTCGAGTTATGAAAGCCCATGGCCTGAAACCGGTTCGAACTACGTAC
AACACCACTCAAGATGGGGATCCCGCACAAGAGGAGTCACAAGAAAAAGAGTTTGCAGTTGGGGCCAGTCAGGGGCCAGA
TCGAATTAATTCCATACCAGCCGAGGACACACAAATTGAGCTGCAAAACAGCCCTGTGGGCCTTGGTGAAGTTGTTAGAT
GGACGCCATCGCCGAGGACGTCAACGCCGGCGCGCCAGCTATTCCCAAGCAGCCGAGGAAGCGTCGAAGAAAGAACAGAT
GGCACCAGTCTGTCCGACGAAGACGAGTTTCCTAGTCCTAAAACATTTGTGCGCCGTCGCCGCCAACGGCTGCATGCCGA
AGGGCTAGCTCAGGATGATACGAGGAGAAAACAGTCCAGGGCCGTGGATCCAGCACTGCGAGATGCGCCAAAGTCTCCAA
GATGGATTCCCGTTCGTGTCGAGCTTTCGCCGGCTTCCTCGCCGGAGCATCATACCGGTCCCCATAGAGAGGTTCGGGAT
ACTGTACCGTCCGTGGCTGGATATTTTCCATCCGGCACGCGTGATAACTCCGTCAGCAACGTTGTGGATGTCGAAGATCT
TGAGGGCGAAGCTTTCTATGAAGCTCTTGGGTCCGCTCCGGAGGAAGATGCCGAGGAAGGCCAAAATGGCTCCGAGGGTG
CACGCAGAATCGGTAGAAGAATACCTGCCTCCTGGTTGATTTTAGAACAAAGGCGTACTGCCAGCAACACAGAAAGACCC
CCCGCAGTTTCACGGCGAGCTGGGTTGCAAAATGTTGATCCCTCTCGGAAGGGAGTAGCACTTCCAAAACGGCACAGTCC
CGGAACTGCTGCTACGACTGACTTTATGTTCGATGACTCTGATGATGACGTTGAGATAATCGGGGATCGGCCACAGGTTA
TCGAAGCAGTTTCTTGGCTCGAAGAATCCCTGGATGAAGCTGAAGGCGAGCGGCGCGAAGCTAATCATGTCGCTAACAAT
TTCGGTGATTTGGGATCGGATATGGAAGAAGAAATTATTGATCGGATGACCTCAGGAACAAAACGGAGAACATACAGGAA
AGGAGGCCATTCGAAAAAAAGACAGAAGACTGGATCAAGCCTCTTTAAGGGCACTCCTGGACAGAAAACAAGACAACCAA
AGATCACCAGGATGCTAGGGCGGTCACAGGCACCTGCATCCTCCGTCGGGTCTGACCGGCATTTTCAGAGGACTCATTCG
GCCCCCCAGCGTCACCTTTCCAAACCAACAGCTGGTCGAAGCCGTGCATTGCTACCTCCGCCTTTGCTCAGCATCCTTGA
TTTGGTCGAGCCTGCGGCACCTGATTTCATTCGCATTGCTGCCCGGACAGCAAGATCGCGCCCGAAGTTAGGAAAGACGA
GCCCTTCTCGGAAGGCCATCAACCTGGGCAGCCGAGGCGACAACGTCGACGCGTTGTCCGTTCTCCACGATTGGAAATCT
GGAAAAATCAGACCGCGGATACAATCTGCGCCGAGGGTTGCAAGACAGCCAAAGAAACCACAACCCCTGGAGGAAGTATC
CTTGAAATATACAAGACGTGGAGCACACAAACCCAAGGAGGTCACCACTACACGGGTTCCATCGGAGGGTTCGTTACAGC
ATGACGGGAACAATTCTTCTGCGACTGGCCTTTCCAGGCGAGTCACAGAGACACAAAAACAAGCGACATCTACGACACAA
AATGGAAAATCTACGGCGCGGCCAGCGCAGCTTGAGACTCTTTCGCAAAACCGGCTAGGGCGGTCCTACTTCATTTCCAA
GAAAAAGGAACTCGATGAAATGTACCGACGAAGGAGAAAAGATGCACATATGCTACCGAATGTTCGTCTGGAGAGATTCA
TTGATGGCAGCGCATCGGTCGACAACGGCATTACCGACGATGGAAATGACTTCCAGGATGACGTTCATTTTATGGACATC
GATCCCCGATCGGCAATAGGGAAAAAAAGTCAAAACGCTTACTCGTGTCAGTCTCGATTTCGAAAAAGAGATGCCCCGAA
GCTTGTTGATACGACGGCACCTCGTTTTGTCCACGCTCTAGATCCCATTCCTTTGGAATTGGGACCCGTCATGGAAGCAC
AGCCAACCTGTTGCACAGAAATCAAAACTGACAAGCTGCTTGGTTTGGGCCTTTTTGGCTCCCAGTACTCTCAACATTTT
GATGTATTTCCATTGGACGGTGGCATCTTTTTGGGTCGTGGTACACTTCTTGGGAGTGGCCGGCTTTCTACGGCTATAGG
GACAGATCCGACTGATGAACTGCATTCAAGATATGCCAAGGTATTCGAGTTCCAGCTAGACGGCCGCAATCTTACGTGGA
CCGTCTGGGATGACAACGCCTCCTCTGAGTTTGGCATTCTTTTGGACTGGCTAGCCGACATTCTGCATCCAAACAATACT
ACACCGGAAAGCCAAACAGGGCAGAATGTCAGCGAAGCGGTCAACTTTGTCCTCGACTTCATCCAGAGAGTCATATCTGT
GTCAGACGTCTCGGAAGAAACACAACACTCGTTTATAATGAGAAGCTTTGATGTCCTATCCTCCTTTGCTGGACGACTGG
ATGCTGCCACATCGCAACACGAAATCCGGGCAACCGACCGAGGGATCAAGAACAACCTGGTTGCCTTGTCGGGCACTGTG
TTGATGGCTATCTGGATGCTGAGGATTTGCCGAGATTCACCTACATGCTTGGCAGTGTCTTTCGACGTAGAGGAGCTGCT
GAAACGGATCGCCAAGATCTCCATCAGACTTTTGTTGAAGTGTGGACTCGAGAGTATTCGCTCCGCGTATGACGACTTCC
AGCAGCCACTGTTCCAGGGGAGAGAAATCCGCGGCGATATGCAGACACTAGTTTCCTGGGCTATCTTGATGCAGAGTCTC
GGCTATGCCAGAATTCCCAAGGCGGGTTTCTGGGACATGACCTACTCAGTCATGCTTGACGGCTCCTCTCTGAGAACATG
CACGGATGCTAAATATATGGAGCGTATGTGGGAAGCCATGTTCACGCTCTTGCCGCTTGGAGAGTTTGATAGTTTTGGCG
TTGTTCAGTCCGGGCTGAGGCATCTTGTTTCTCTCGATGGCTGGACGTTACCTCGGGAGGCCCTGAACCGCGTCTTCCAG
GTGTACAAGGAAAATACCCGACAGTCTCCCAGCTTCAATGCCTATTGCCGTGCTCTGCTTGGGCGCTGCCACCTCTTAGT
AAAGGAATGGGGCTGGCAGCGTTGCAGCAGTATTGTCGGTGTCATATTCGACTTTTTCGGACAGCAAGACTTTGCGCATT
TGCGAAACGAAGAGGCACATGCGTCTCCCCGATTTCTGGAAGAGCTAGCGGACTCCCCTTCTCTTGACCTCACCCCTGAC
GATAAATGCTTCCATATTTTTATCAAGATGCTTGGACTTGTCATATTGCGACTCCGAAGACTGGATCTCACCAATGAGCT
TCGAAACCTCATCACGCGAACGCTGCCCAACCACAACCGGCAATACCTCAAGGAACAAGACATCCATTCGGGCGAGCTTG
CAGCGTTACGGAATCATCACGACCTTCTATGCACGCTATTTTGGGCGGCGCCACCGGAGCTTCGTCCAGGTGTTCACTTG
ATCGAGAAGCTGGTAATGCCGGGGAGTTCGCACAAAGAAGCTTGCATCATCAATATTAGGGCATGGAACCAACTCGCTCG
TTTTGTGGTCGCAAATGGAGAGGACTACAACATCTACAAAGGGTTTGCCTCGTGGATGAACAGTATCTTCCAGCAGGTCC
TTGAGCAGTTCCTCTCTGTCGAGGCAGACATGCAGAAGCAGCTCCTGAGACTCTCAGAGAACATGATGCTTGGCATCAGT
CCGCACATCGTTAAAGCCATGGCAGCCAAAAACAGAGCGGCGTCCCTGGATGTTCTGCACATGTGTATAACCGCGTCCCT
GGATGTCCTCAAGCACACAAAGTCGCTCGAGATGGCGACCTACTGTTTCAGCAGCATCCAGCTGGAGGCGATCTTCACCA
AGATCGACCTACAACTGTCGGGATCCGACTGGGGTGTACTCCAGACCGCTCTTGATACAGTATCGCACTATTTGGACAGA
GTCGAGAAAGCGATGGACGAGCAGTACTCGAGTTCCTTGGACGATGTTGATGCGCATGCGACGGAGGAGGCTGTCATGAT
GCTTGACCACAAGCTGGCAAAGAGTCTCTTTCATCTGAATAGTTCCGTCACTCGCATGCCGTTGGACGGCACGTGTCTGG
CATCCAGATCTCGCGTGGACTGCACAGAGAAGTGCGTAGCACTCTCAGCACGGCTTGCAAGTCGCTTTATCCATTCAGGC
GTGTACCGGCTGTCCCTTTTTTTCGGCTCTGGAGACCGCAGCCTGTTCGAGCGGCTGCCACATGCGCCAGGTCTCGCCCA
AAGAAAGTTTCTTCCTCTATTCCTGGCAGCTATGGTTCAAAACAACGTGTTTGATTTCAAAGATATCGGAAGCAGCATAT
TGGAGCTCTGGTTGCTGGCCATTGTCAAGCCGGAACGGTTTCTAGCATACGAGATTCGCCTGGCAGAAACACTGAAGCGG
CACGATGTGCCGTATCTGAGAAAAGCATTCGTCCCTACGAACGGTCAGCTGCCCAGCTACGACACAAATCGGGCGTTTTT
TGCCTGTGCACTCTCTTCGATGCGACTGTCTCTACAGGAAGCAGAAGCTGCGAGACGCCAGCAGCTTCGGAGCGACTTTG
CGAGGGCGCTGAAGTTGGTGATGCGGCAGATGAAGGAGGATCTCAATTACGGCAAAGCGGAAGCAGCACCGCACGAGAAG
TATGTGGGGTTTGTACGATGCATTGTGGCGCTCATTAAGTCGCACGGTGGCGACATATGTCCCCTGGACGATTTCTTCTA
CCAGCAGAGCCAGGACTACTCTCCCTCGGTCGAGGACCCGCAACTGCAGACAGCCGGGATCATTGCGTATGGACTGCGGC
TCGGAGAGGGTGAGGCTACTGCGGCGCCTCAGCTCTTTCACTATCTGCACAACAACTTCAACATTGCGCTTGCCAACAAC
CAGCTGGGCAAGGAGTGCGAGATTCTGGAACGTGGCATGGACAACAACGAGGTGCTGCGGTTCGTGTTGGAACGTCTGCT
GCCAGCGATCATCCGAGCGACGGGCGACACATGCGACGCCTGGCCGATGCTGGCGGTGTACTGCAGCGCATTGCAGAGTT
TGCTGACGCGGTGGGACGTGCCAAAGGATATTGGTGACGAGAACATGGCTGCGGCGATCGGAGTGATGGACGAGATCCTG
AACTGGCTTCGGGGCAACTGGCGAGGAGGCAGCAGCTTAAGTGCCGACACAGGTGGCACACGGATGCTGTCGTGCGTACA
GGTGCACGTCATGGCCCTATTGACAGCCCTGGCCAACGTGCTGCAACCTGTCCTGATGACGTGTTCGTACTTGGCTCTCT
CGCCGAGCACAAGCACCGGATTGGACAGGGTGGTGCGCGAGTTCCACAGCTTTGCCACAAGGTCATCGGATATGCTCAAG
CGGCGGGCCAACAGCGGGGAAGGGCTTGCAAGCAGAGGTGGCGAGAGAGGCGGCAGCATCCCGCTTTCTGTGGTACTGGG
TGACGACGGAGAGGGCAGCGGTTTCTCTGGGAGGCGGGGCAGCATGGACGGCTATGAGACCGGTCTGGACAGCGTGCCAG
GAACAGCACAGGTGAACATGTTTCGCAAGCTGATCGTCCGTCATGTGCGCGAGAACTGGGTTGTGGGCGACGGGCAGATT
TCGGTGCGGAAGGCCAGCGCAAGAGCAGGAGGAGCTGGGGATGGCAGCGTCAACAGTGGTGCAGCAGCAGCGACAGTGGT
AGCGGCTGGCACGGCTTATGGGCCATGGACGATGGGGGAGCTTCTGGACGAGCTGCAGCGCCAGGTGTGCAGTTGGAAAC
TGAGGCCGACAGGAGGAAGAGGAGGGGGCGGGGGAAAGGGAGGGGGGGGCACAGGGAAGGGCGGTGGGAGGGACAACGGG
CCGAATAAGACGTCTTTTCCCAGGCAGACGAGAGAGGACAGACGAGGGGACAGACGAGGGGCCAAACTAGGGGACAGACG
AGAAGAGGACAAAAGAGGAGGTGTGAGATGGCGTTTCGGATTGTAAAACATACGGCCGGCAAAAGGATGGAGGCGTCACA
GCGAATGAGATAGAGAGACAATAGAGGTTCTTTCTGGGTCGAAGAAAAGTTTGCTGCCTAAATTGTGCGCCTTTTTCGGA
CGGATTGTGGTATTTGGGCACGACAGCCTCGTCGGCTAAAAGCAGGGTGCAGGGTGCTGAGTAAGTAAGGGATCTTGCGC
AGCCTTGCGGACGCTGAAGGAAATCAGATACGGAGTACTCCATACAATACTATTATATAATGGGAAGGGAATCAGTAAGG
GACGGAGGTGCCGGCAGCAACTGCCGAAAGCGTTGATAGCGGCAAAGGGCACTATGTACTGACTCCGTACCGTCCCAACA
ACGGCACCCACCCTCTCCTCACATCTGGCACCACTCCGCCCAGATTCACATGACCCGGCCTCGACCTTCCTCAAAAGACT
GTTCCGTGCTAAGACGACAGCGCCGGCAAGCAGCCCCCCGGCCAGCCTGCTGACCGCACAGTCCAGTGACGGCCATTCGC
ACGTTCGCACGGTGGTGGGTTCGCCTGAGGTAGCACAAAGCCCTCTGTGTCGATTGCGACTGCTTCTCGTATGGCTCGCA
TGCGATGCTTGCATATTTGGCGGGCTCGCATATTGCTGGTAAGATACGTCGTATGCTGGCGCGCCCGCCTGTATGCTCGT
ACTCGTACGCTCGCATCGTACTCGTACGCCCTGCAGCAGGACGCCTGCAGCGACCGGCTCTCCTATCGTCGGCCTTGGCC
ATAGTGCTATTTTCCCGGTGGGGAAGCCGCCGATTTCAGGCGGCCACGTTTGGCCATTGGGCTGCCGCAATCTCGCGGTT
TCCTGTTTCCCACTGTTTCGCCATTCTATTTTATTCCGTATTTTTTTTTTTTTTTGGCTCGTCGTCCGACTGGGGCCCCG
TACACCACCTGCGGTGACTAACTCGTATCTCTACCGCCAGCGGGGCCGGCCTCTCGCTCAGGCGTTGATTGGCGCGTCCG
AGCCTGTCACTGGCTCGCTGCTCGGTCACGTGTCAGGCTCGGCAGCGGTGGGAAAAAAGGCTCAGAGCCCGCCCACCTCC
CATTTTTCTGGGCCCTTCTCGCGACGTTATTTGCTGTCATTTCACCTTGGGCAGCCTTCCAGCCTGTTAGTCCTGTCTTC
CCTTTTGGCGACCTAACCCCTCTCCCTCTCGGTCTCTCCTCCTACTTTTTTCCTGGGTTCTTCCCTCGTCTTTCTCGCGA
GCCTAAAACACACTCCAGCGTTTTCCAACTTCAATTTCTCGCCGTTCTTTTCTCCCATCTCTTGCCTCGTCACTTTGTCC
TGCTTGTCAGTCGGCATCTCGTGCACCTCCAATGGAGCTGTTCTGAGAATTGTCAACCCCCAACCCCCCCCCCCCCTTCC
TCTCCTCCCTCTCCTTCTCCTCCTTTCCGTTTCCCCTTCCCGACTATCCACCCCCGGTCAACGGCTCTTGCCCCCAACTC
CTGGCCGATCCAATTCTCAACCACCACCGGCCGCGGATCTCGCCAACCCCGAGAAATCCTATCAGTCGGCGTGCGCTAGC
TTTCACTCTTCCATCTCTCCACCCCAGACTAATACCATCCTCCGATTCTGGCCGCCTTTCATTCTCTCTTTAACTGTTAG
CCTCTATCCTGTTCCCATCGTGTCTGTCTTTTTCCGAGGTTCGACCTCGAGGTGGCCATTGCCGTTGGCCTTTTAATGGA
CCGGAAACGGTCCCGTGACCCAGACGATGAGACCAGCTCGCCGTCTGGGAAGCGGATGCGTCAAGAGGTTAAGGCTGGGG
CCGACGCCTTGTTTGCGACCAGCAACAATGCCATGCAGGCTGTAGCTCATGAGGCTCTTGCCATATCCCACGGCGGCGGC
GGCTTTTCAGCTATAAACAGTGCGAATCGCAAAATCGTCCCCAGCTCAACCGCCATTGCCATAGCCACCGCCACAACCAC
AGCCACAGTCACAGCCACTGTTAATGGTGATAGCAAAGGCAACGGCAACATGAATGGCAACGAAGACAGTAACGGTAACA
TCACCGGCAACAGTATCGGAAATGACAGTAGCGTCAACCGCTTGTCCTTTGAAAGCATGAGTGATATCACCCGCAGCTTC
AAAAACGCGGTTGACAAGGCCTGGGACTGTCGGTCGCCGACATATGCCGGCGTCCACGTCCTCCTGATCTACTGGGATGA
GGATGACGAGGCTGTCAAGGATGCAGCTGCCCAGCTTGAATCTGTCTTCCGCACCACGTACCACTTCGATACAGACATCT
TCTCCATTCAGTCCGCTGTCTCCTGCGACATGTTGTATGCAAAGGTCGAGACGTTCTTTGCCAGCAACAGCTCTCCGGGT
GACCTGGCCATACTGTACTATGCCGGCGAAATCGAGGCTAACCGCCTGGTCGGCGAGGCTCCAGTCTGGACTCCGTACGT
CTCGATCCCTTTTTTGTCTGAACAGCTCGGCTCATATACCGGCTCTTCCCCCCTCGACGTCTACTGACCGACCCAGACGA
GGACAAATCGGCACGGCCAGCATCGAGTCGAAACCTATCCAGGCTGCCTGCGAAAGTGCCAGCTGCGATGTTCTTCTGCT
CTTTGATTTCTGCAATGCCTATCACTACCCTCTAACCAAGGCAAGCTACGGCACTGCGCGTCGGAACGTCGTCGAGGTGC
TCGATGCCCCCACCTTTGACCTGGACTCAAGCTCCATCTCCTTCACCATGGCGCTGGCCGAGGAACTGTCTGCTGACGCC
CTTGGAGGCCCTATCTCGGTGGAGGCCATAAAGGTGCAGGTCTCTGACCGTATGACCGTTTCGAAACCTCGAGGGCGTGG
ACGGCCTCCAAAGGATCCGCAGGCAAAGCCTCCCTGTGATCAGCTGCACCTTCCAAAACACTACTTTCTCTTCCAGAGAC
GCAGTATCGTCTTGACTCCTTTGCCAGCGGAGCCTCAGAGTAAGTCGCAGCCTTGTATCCTTGCGCCGTGCCGAGCACTG
ACCATTGCAACCATATCAGTTATCTTGTGTCTCCGAGTAAGAGGCATCCTTGATGTTAATGAATGGGGAAAGTGGATTTA
CAACGCCGCTCCGGAAGCTCGCGATGCTGTCAAGATCGAGGGTCTTCATTCTGGCTTCTCGACCATTATAGTCTTGCGGG
TGCCTGTATCTGAGTGGAGTCTCTTCTCAGAGTGTCCGGCGGGCTCATTTGTGGGCTATACTACTGTCGGCGACATCGAT
TCTGGTACTCTGGAAAAGATTGACAAAGATTTAGCTTCAAAGCTGTGGTTCGAGGAGGCGCCACCAACGCGGATACAGCC
GCCAGAAGCACTTACCCCTGTCCCTATAATAGACGCGACCGACCCAGGCATCGCAACGACTACATCGATCCCTAGAGCAG
TCGGCTCAGCATCACCGGCCACTCCAGTCGACGGTGACATGGATAGCACTTTCACGTCGCGTACAGGTCAGAAACGAGCC
CGAAAAGCATTGCCGACGGAAAGAAAGATTCTGCCCTCTGAGCCGTCTCCAGCTTCGCTCCGCAAAAGGGAGTACGCGCC
AGGCGACGAGCGCAAGGCAAAGGATTACCAGCTTCCGCACCACGGCCAAATCTACTCGCAGCAAAAGCAGCATGGGCATG
CGGTAGATGATGGCGGCCTCGCGGAAAACAACGTCTTGCTCGCAGCGGCACAGAAACCGTTCAAAATCTCGATCAAGCTG
GCCGGCCAGACACACGTGTGCAAGGAGTGCAAGGCCGGCTTCAAGGATGGCGACTCTCTGCAGAACCATGTGCGAAAGCT
GCACACGCGCCCTTTCCACTGTGTTTTCCACTGGGCTGGATGCGAGTCTACTTTCGCTAGCAAAAACGAGTGGAAGCGAC
ATGTGATGAGCCAGCATATTCTGCTGCAGTACTGGGTTTGCCAGGTTGAGATGTGCAGCAAGGTGATTAACAAGGTCAAC
GGCACGGGAGGCAATGGGGGCAGCAATACCGCTCTTGACAGCACCAGTGGCGGCGGCAGCGGGTTCTCTCTGCCCAACGG
GGCAATCTTCAACCGGAAAGACTTGTTCACTCAGCACCTCCGCCGCATGCACACGCCGCCACATGTGAAGAAGCTCCTGA
AGCAGGCCAAACAGGGAGCCAAAATGCCGAACCACGCTTCCATCATCGAGTGGGAGAACCGGCTGAAAGACTTGCAGCAG
GATGGGCTGAAGCCACGTTGCCGGCTGCCCGACTACATGGTTTGCCCGGCACAGGGCTGTGGTATCGACTTTCACGGAAA
CAATGCATGGGACGATCGGATGGAGCACGTTGCCCGTCACCTGGAGGCAGCCTCTGCCGGACGGGAGCCTCCAGTGGTCT
TTGGCGGAAAGACGGACACGACGCTGACGAACTGGGCCACACGGCTGGAGGTGGGCATCGCAAAGAGGGTAGGGCCCGAT
ACGTGGCACCTGGACAACCCGCTGCGGCCAGAGATCGTGGCCTGGATGGAAGATGTGCATAACCATGAGCAGCCGGGTGT
GGTGCAGACAAATGCAGGGCGAGAGATGGAGCCGCCCATCAGGCGAGAGCGGTCGAGATCGGTGATCGAGGTTGCGGAGG
AGGGAGGACGACACGACCCGAGCGGACGACGGGTCGAGCAACGGGAAAGCGGCGCTGGTGTGATTCCAGTGAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62