GenePrediction:GLEAN_5372 Details

Name: GLEAN_5372
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:70842..68720 (- strand)
Length: 2123
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:70842..69367 (- strand)
Length: 1476
Type: CDS
Source: GLEAN
Position: GCSC_97:69319..68932 (- strand)
Length: 388
Type: CDS
Source: GLEAN
Position: GCSC_97:68868..68720 (- strand)
Length: 149
>GLEAN_5372 class=GenePrediction position=GCSC_97:70842..68720 (- strand)
ATGTCCAGGCTACTGCGCCCAGGTCTTGTCCGGACGGCTGCCATCACAGCCGGCGTGGGCACTGCTACCGGTGGACTCAT
CTGGTACACGTACCGGCCACGAAACATCCCCGGCTATGCGCCGCCGGCCGTGCCTCCCCCCAAGTTCGGGGCCGATGGCA
ATTTCCGGCTGCCGCGGTTTCCGCGCACAAAGGACCGCGACGAGAACATTGCAGCGCTCCGGCAGAGCAGCACGGCCGAC
GGGACGGAGTACGACATGCTCGTAATCGGCTGCGGAGCCACGGGTGCGGGTGTGGCCCTGGATGCAGCCACACGGGGCCT
GCGGGTGGCCGTGGTCGAGCGTGACGACTACAGCAGCGGCACCAGCAGCAAGAGCACCAAGCTGGTGCATGGCGGCGTGC
GATACCTGGAGAAGGCGGTCTGGAATCTAGACTATGCACAGTACCGGCTGGTGCGCGAGGCGCTGAAGGAGCGCAAGTGC
TTCTTGCAGACGGCACCGCACCTCAGCATGTGGCTGCCGATCATGTTGCCGCTGGACAGGTGGTGGAAGGTGCCGTACTA
CTGGATGGGCACCAAGTGCTACGATTTTCTAGCCGGAAGCGAGGGCATCGAGAGCTCGTACTTTCTGACCAAGTCCAAGG
CCGTCGACGCCTTCCCAATGCTGAAGCAGGACGGCCTGGTGGGCGCGCTGGTGTACTACGACGGCGCGCACAACGACTCG
CGCATGAACGTGTCGATCGCCATGACGGCGGCGCTGTACGGAGCAACGGTGGTCAACCACATGGAGGTGACGTCGCTGAC
AAAGGACGAGGCCGGCCGTCTGACGGGGGCGCGAGCACGTGACTGCGTGCCTGCGCGGAACAACAAGAACGCGGACGAGG
TGACGATCCGGGCACGATGCGTGGTCAACTGCACCGGTCCCTTTACGGACGGGATCCGCAAGATGGACGACCCGGGCTGC
ACGGACATTGTGGCGCCGGCTTCGGGCGTGCACATCATCCTGCCCGGCTACTACAGCCCGGGCAAGATGGGCCTGATCGA
CCCGTCCACGTCGGACGGGCGCGTCATCTTCTTCCTGCCGTGGCAGGGCAACACGATCGCCGGGACGACGGACGAGCCGG
CAGTGATCAGCAAGAATCCGCTGCCAGACGAGAAGTCGATCCAGTGGATCCTCGGCGAAATCAGCCATTACCTGTCGCCC
GACATCCAGGTGCGGCGCGGTGACGTGCTGGCGGCCTGGTCCGGGCTTCGGCCGCTGGTGCGAGACCCCAAGGCCACGCG
GACGGAAGCGCTGGTGCGCAACCACCTAGTCGACGTGTCGGCGTCGGGACTGCTGACCTGTGCCGGCGGCAAGTGGACGA
CGTACCGCCAGATGGCCGAGGAGTGTGTGGACGCGGCCGTGCGGACATTTGGGCTGCAGACGCGGCCGCTGTCGAGATTG
ATGTCGAAGATGCCTCGCATCAGCGGCAGCGACGACGTCGACGACGGCGCCCTTTCTTCGACGGCACCTGCCAGACGCAC
CAGGTGCGGCTCGTCGGCGCTCACGGCTTCAGCCGCACCCTCTTCATCAACCTGATCCAGCACTTTGGTCTGGAGACCGA
TGTGGCCCGCCATCTGACCGAGAGCTACGGCGATCGTGCCTGGACGGTCGGCGCGCTCTGTCGGCCGACCGACCGCCGCT
TTCCGGCGCGCGGCGACCGCCTCTCGCAGCTGTACCCCTTTGTCGACGGCGAGGTGCGCTATGCCGTGCTGCACGAACAC
GCCCAGACCGCCGTCGACGTGCTCGCACGCCGCACCCGTCTGGCCTTTCTGAACGCACAGGCCGCTCTCGAGGCGCTGCC
ACGCGTCATCGACATCATGGCACAGGAGCTTCGCTGGGACCGGAGACGACAGGACGTTGAGTGGAAAGATAGTGAGTGTG
GGCCTTTGCCAGGTTGGCTACCAGACACTGTTTCGTGTACGCTAACACGGCCAGCCGTTGCCTTCCTCGAGTCCATGGGC
CTGCCACAGCCCATGCTGACGGCTACGAGAGCCCAGGTCGAGTCGGGAAAGCTCGACTTTTCCACGTCGCTCGAGTACAA
GATGTACTCGCGACACGACATGCCGGTAGATGAGTCCTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62