GenePrediction:GLEAN_5373 Details

Name: GLEAN_5373
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:54225..52437 (- strand)
Length: 1789
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:54225..53954 (- strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_97:53886..53118 (- strand)
Length: 769
Type: CDS
Source: GLEAN
Position: GCSC_97:53051..52437 (- strand)
Length: 615
>GLEAN_5373 class=GenePrediction position=GCSC_97:54225..52437 (- strand)
ATGTCTCCTGAAGTGGAAGCACCCACCAGTTCCCCTATGCAGGTTCCTCTCAGTCGCTCGCCCTATGGTTCGGGCGTCTC
CAGCAAGAATCTCTCAGCCATTCACGGAAATTTCATTCCGCTCCAGAGCTCCGAGGGCCTTTTCTTGGTTCCTCCACGGC
GGGTGAAGAACCCCCATCGACAACGCTCGCATTCCCCACGACGCCGACAGGATAAGGGTGTTCATCTTCATCTCAGTCTG
ACGGACTCTCAGATGGACAAGCTCACTTCGACGTGCGTTGACCCGCGTAAGCGGCCCGGTGAGAAGATGTCACCTTACTA
ATCCTTGCAGATTGACTAGAGACAGCGAAGCTGATTTGGCGTCGGGTCATGGAGCCCATGCAAGACAACGTGACAACACT
TCACCGCCCATTCCCGTTCAGCAGAACGATGTGCCCGTGCCCTTGGCAGCCCCGGCTTCCGAGCAGGATTCGAGAAGATT
CGTCCTGAAAGAATCTCGCGATAACAACCGCTACGGGGGCCATCAGAAAGTGTCCGATCCCGCCCATGTGGACTGCTGCG
CACAGATGGCTTATAGACGGACACGATCCAGGTCCCCTGAAAAGATGCGCTCGTCTCCCAAAAAGAGCGGCCATTGTCCA
GAGAAACAGGCGGAAGAAGCCGACATAGCCGACACGACCTCGTCTGTGTATTCAATGGAGAACTTTCCCGACATCCTCGT
CGACCCTTTGTATATCAGCAAGAACCACGAGGATGTGGTTTATGGCCGTCAACCTAAAGTACTGCAGGAATATGCGAGGT
GGTCAATGTCGAATCCGTCTGGCAGAGGCAGCGGCAGCACTCGACAGGCGACTGAGCCAGATCACTCTATGGAGTCCGGC
CAATCCGGCAGTAATGAAATGTACAGTCCCAAAGCTGCCTCTCGCCCAGACTTTTCGCCTTTGACGAACTACTCGAGCTC
GCCCAAGCATACGGCGCCGCAAAAAGGAAGGAAAATCATGGTTGGTAAGAACGGCTGGTTGGAGCGGACAGGCGATTCGG
GGAACAACCCATCGCCGCCAAAGAAGAGCGGTATTATGGGCACACTGAAGCGAATGGCAAGGGAGGTTGTACGTGACCTC
TGAGCAGACATCATCCTATATTTGGTGTCCTTTTACTGACCATGACGTGAACAGGCCGAGGCAACAGACATCAAAGTCGT
CCGGCGACCCAAAGATGGCAAGCAACATGGTCGCATGTCACGCATGCGAACGTCGCTGAATCCGCGAGAGCAGAGCCTCC
TGTACAGCGAGCTGGAGTTTCTGCTGACATCAGCGCTAGATGGCTACATCACCAGCCAGTTCAGCGCGGGCCGGCTGGAC
GCGGACAGGTACAAGAAGGTGGCCGACATGTGGCAGCACAAGGGTCGTCCCAGGGTTGTTGGCTTTCGGTATGACTTGGA
GACGCAGCTGGAGCTTGTGCATTTGCACGTGGATGAGTTCCGTTTCTACGGCGACAGAGCCGGCGTGGTCGTTGCCGTGA
TTGGGATACTCGAAATGATGAAGGTGAACGCGCGTGCGATGCGCATCCGGACATTTTGTCAGCCGGACCCAGTGATCGCG
AAGCAGTTGCTGGACTCTCAGAGCTTGTTCAACCTTCTCGGCTGTTCCGAACCGTGCCAGATCCAGCTTGCAGAGGTTGT
ACAGTTCTTCAAGGTCGTTCTAGAACGGGAGCACCGCACCTATCCTGGGGAGAATTCAGTCAGCACGCAGGGGTCTCTTG
CAGGCCAGCCGCCCTCTTGGTCTCACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62