GenePrediction:GLEAN_5375 Details

Name: GLEAN_5375
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:50224..48539 (- strand)
Length: 1686
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:50224..49952 (- strand)
Length: 273
Type: CDS
Source: GLEAN
Position: GCSC_97:49884..49870 (- strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_97:49756..48539 (- strand)
Length: 1218
>GLEAN_5375 class=GenePrediction position=GCSC_97:50224..48539 (- strand)
ATGAAGCCTTCTCTCGAAATCCAGCTCGCCGGCAAAAACAAAGCCTCCTTTGCCCGCCAGACGATTGATATCAGCGAGAA
GTCGTCATCTCACGCGCAGCTTGCCTTTTCTGCCGTCTCCACGTCCAAGGATGAGGAAGCTCATCTTCCAGATCCAGAAT
CGCGGGAAGAGAAGCCTCTGCAGAGATGGAACGATCCGAAACTCAACATGTTCCGCTACTTTTCCACACTCTACTCCTTT
GTCGTCATGGGAATGAATGATGCTGCCGTTGGCGTATGCTCTTCCGCTCTTGCCCTCGTTTCCCACTCGCGTCAACGCTC
TCGCTGACACCCGTGAACAGGCTCTAATACCATATGTAAGCAGCAACTGGTCAGCATCCTGGACTCTATCCCAACACCCA
GCACCCATGTATCCTCACAGCCTCGCAGCTTTCAAATAGCAATGCATGCTAAGCGATTTACGGTCTAGATGGAGAAGTAC
TACAAGGTCTCGTACACTGTCATATCCCTTCTCTTTCTCTCGTCATTCCTTGGCTACATAATTGCTGCCCTTCTCAACAA
CCTCATCCATCATCATTGTGGCCAAGTTGCCGTCGCAGTTTTGGGTCCTCTTGGCCGCCTAATCGGCTACGTTCCCATGG
CATGCCACCCACCCTTTGCCGTGCTGCCAGTCATGCTGTTATTCCCCGGCTTTGGTAATGGCCTGGAAGACAGCGCGTGG
AATGCTTGGATAGGCAACATGCAGAATGCCAACGAGCTGCTCGGCTTTCTACACGGCGCCTACGGTCTCGGTGGCACCAT
TGCTCCGCTAATCGCCACCGCCATGGTGACCAAGGGCAACCTGCCATGGTACACCTTTTACTACCTGATGATCGGCATGA
CTGGCCTCGAGGGAGTCTTTGCCATCACGGCTTTCTGGGGGGCAACTGGTCGTGTGCATCGCGAGAGCTACAAACCGGCT
GCCGAAGGAGGCCGCATCACCACCAGGCACGTTCTGCGTGAACCCATCACCTGGACCGTGGCGGTGTTCCTCCTCGGCTA
CGTCGGCGCCGAGGTCAGTCTCGGCGGTTGGGTCGTTTCCTTTATGCTGAATGTCCGCGGCGCCGAGAGCTTTGCTGCAG
GCTTGACCGTGACCGGTTTCTGGCTCGGCCTTGCAGTTGGCCGAATCGTCTTGGGCTTCGTCACCGGACGCATTGGAGAG
AAGCTGGCCATTACCATCTATCTGATGCTATGTATCGTCTTGCAGTTGCTGTATTGGCTTGTACCCTCATTTGTTGCCTC
GGCCATTTTCGTTGCTTTTCTTGGCTTCATACTAGGCCCTCTCTTCCCGGCTGCCATTGTGGCGGCTACAAAGCTTCTCC
CAGCCGACTACCATGTCTCTGCCATCGCATTTGCAGCAGCTTTCGGTGGCGGCGGCGCTGCCGTCTTTCCCTTTGCCGTC
GGTGCGATTGCCCAAAGCAAAGGCGTTCAGGTCCTACAGCCAATCGTTCTGGCCATCCTTAGCTTCATATTCATTGTGTG
GTGCTTCCTTCCAGGAGGTCTCCGGCCGGGCGGCTTGGAATATGCCAGAGATCACAACGAGAAGGTTGGACATGAGGTTT
GGAGTGCCTATCGATGGGTCGCAAGCAGGTTTTTTGGTCCGAAACAGAAGCCGATCGCTGCTTCAACAACTGGCGTCGAT
CCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62