GenePrediction:GLEAN_5376 Details

Name: GLEAN_5376
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:44668..43113 (- strand)
Length: 1556
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:44668..44453 (- strand)
Length: 216
Type: CDS
Source: GLEAN
Position: GCSC_97:44378..43225 (- strand)
Length: 1154
Type: CDS
Source: GLEAN
Position: GCSC_97:43161..43113 (- strand)
Length: 49
>GLEAN_5376 class=GenePrediction position=GCSC_97:44668..43113 (- strand)
ATGGCCAATCAGGCGCTCAACTTTGTGACCTTCAACCAAGACCACAGCTGTCTGGCTGTCGGTACATCCAAGGGCTTCCG
CATATACCACACCGACCCCTTCTCCAAGATATTCAGTAGCGATGATGGAAGCGTGTCGATCATTGAGATGCTCTTCTCAA
CGTCGCTTGTGGCCATGGTCCTATCTCCCAGACATTTGGTGATCCAAAACACAAAGGTGAGATGCCAGCAAGAGGCTGAT
GAGTAGAGGCAGTCCTGTGGCTCGTGCTGACATGCATGCCCGTTATTCAGAGAGCCTCTGTTATCTGCGAGCTCACTTTC
CCCTCGGCTGTGCTCGCAGTCCGCCTCAACCGAAAGCGCCTTGCTGTCGTGCTCGAAGACGAGATCTACCTATACGACAT
CGCCAACATGAGTCTTCTCTACACCATAGCCACGTCGCCAAATCCGGGCGCCATCTGCAGTCTCTCACCGTCTTCCGAAA
ACTGCTACATCGCTTATCCCCTCCCGAAGCCCCGCGAGGACCGCGACGAGAAACGCCCTTCACATGCGCCGCCACTGTCA
GCTTACGTTGCGCCTACATCAGGTGACGTCCTCATCTTTGACACGCATTCTCTAAAGGCCGTCAACGTCATTGAGGCCCA
TCGGTCGCCCTTGAGCTGTATCGCCATAAACAGTGATGGCACAATGTTAGCCACCGCATCCGAGACCGGCACCATCATCC
GCGTGTTCAGCGTCCCTAGCGGACAGAAGCTCTACCAGTTCCGCCGAGGCACATATCCCTCGACCATATACAGCATGTCT
TTCAATACAAGCTCGACGCTTCTGTCTGTCTCCTCAGCGTCTGATACCGTGCACATCTTCCGGCTGGGCGGCCCCCAAGG
ACCGCAGTCGGCTGGCGGATCGGCCTCGGCTGGCGGAGCCGTCGATGCTGGCTCACCGCGACAAGACCGTTGGACCCGGT
CTCGCAGCCATGACAGTCTAAACGACTCTGTCGGAAGTGCGGCCGGCTCACCGCGCAGCGATGCCGCGGATCCGACGCCT
GGCTCTAGCCGGGATGGCGGTTTGGCCGTACAGAGGAGGCAGAGCGGCTCCTTTGGCAGCATCCTGAGGAGGTCATCTCA
GATCATGGGCCGGAGTGTGGCCGGCGTCATGGGGTCCTACCTACCACAAACAGTAACGGAGATTTGGGAGCCACTGCGCG
ATTTTGCTTACATCAAAATCCCAAAGGCTGGGTCCAACACGGCGCCCAAAACCGGTGCTTCCAGCTCTCCGACCAGTAAC
GCCTTGAATGCCGGGTCCGGCTACTCTGGAGGGCCAGTTAGAAGTGTCGTAGCGATGAGCAGCAACAGTCCTCAAGTCAT
GGTTGTCACTAGTGATGGCGCCTTTAGTGTTTTCAACATCGATTTGGCACACGGCGGGGAGGGCTTCCTTATCAAGCAGT
TCTCGTGAGTCTTCAGCACCACGCCTGCATACCTTCTTGTCCAGACAACTAACAGATCCATCTATAGGATTCTTGATGTC
GATGAAAGGCTAGATGCATCTTCGTACGGGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62