GenePrediction:GLEAN_5377 Details

Name: GLEAN_5377
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:38723..36135 (- strand)
Length: 2589
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:38723..38308 (- strand)
Length: 416
Type: CDS
Source: GLEAN
Position: GCSC_97:38228..37169 (- strand)
Length: 1060
Type: CDS
Source: GLEAN
Position: GCSC_97:37089..36967 (- strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_97:36887..36742 (- strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_97:36668..36454 (- strand)
Length: 215
Type: CDS
Source: GLEAN
Position: GCSC_97:36389..36280 (- strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_97:36209..36135 (- strand)
Length: 75
>GLEAN_5377 class=GenePrediction position=GCSC_97:38723..36135 (- strand)
ATGCGGACATCTACCGAACAGCTTGCGGCTGCCGGTGGCCACCACCTCACGGGGCGCGGTCTCGCCGTCGGTCTCGCCGT
CGGTCTCGTCATCTGCTGCTCCAATATGTACTTCGGCCTGCAGACCGGATTTATCAGCACCATGTCGCTGCCCTCAAGCT
TGCTGGGCTTCGGTATATTCAAGGCTCTTGCGCGCCACTTGTCATATCCCTTCTCGCCCGTCGAAAATGTGCTGGTGCAG
TCAGTGGCCGGCAGCATGGCCATTGCGCCGCTGGGATCAGGCTTCGTCGGCGTCCTGCCGGCCATGAATTATCTGCTTAC
CCCGGACGAACAGGGACCCATCAATTTGTCTCTCATAAAGACGATATTCTGGTCTCTGGGGCTCTGCTATTTTGGTGTTC
TCTTCGCCGTCCCCCTGTGTGTTGCGCCCTTCTGCCGCGTCGAGACAAGTCCTCCTTCACTTGCCATTCCATTCTTTAGC
TAATGAATGGTACAGTCGTCGCCAAGTAATCATCCGGGAAAAGCTCAAGTTCCCAAGCGGCTTCAGCACGGCTGTTTTGA
TCAGCGTCCTTCACGGAAGAAAGAGCAAGATTACCCCGGGCAGCCTTCCAGCCGATTTTGCCAGCCTGGCTGGCGAAGAT
GTGACGGCTCTTCCTGCTGCTCCCCCAATCCCTGCCAGTGCTACGATTTCTGACTCGTCGCCTGTTACTGCTGCCATTGA
TGGCCAAGGCCCTACCTCGGAGCACGAGCTTCGCCGCCGGGCAGAGTGGCAATCCAACCTGAGGCTGCTTCTCATATGTT
TTCTCATCTCCGGCCTCTTCACACTGGCCACCTACTTTTTCCCCATTATCAGGAACCTGCCCATTTTCGGCCATACTGCT
GCCCACACGTGGCTTTGGACCTTCAACCCCAGTCTTGCCTATATTGGGCAAGGTGTCATCATGGGGCCTGCAACAACAAT
GCATATGCTGCTTGGTGCTGTCGTTGGCTGGGCCATTCTGTCTCCGTTAGCAAAACACCGTGGCTGGGCTCCGGGGCCCA
TCGACGACTGGGAGAGTGGAAGCAAGGGCTGGATCGTGTGGATCTCCATAGCCATAATGCTTGCCGATGGTATAGTCAGC
CTGACACATGTCTCTGTCCGCTCTGCCATCCAGTACTGGCCACAAACACGCTCTGCAATTGCGAAGCGGCTCCAATACAC
TGTCTTTGCCGGCATTCTCCCTCGACGGCGGCCTACTGGCTACGTCGCCGTCTCCAGCTCCGACGAACCGACCAATTCTG
ACTCCTTATCTTTACCGACTAGTGCATTGCCAGTCGCTGGTCTTGATCATGAGACTGATGCCTTGGTCGACGAAGAGCCC
TTACCCGAGCTTGATGCGCCACCGGAACAGCAGGTCGGGACAAAGGTTGTGTCCATTGGACTCGTGTTGTCCATACTGTT
CTGTATTGCATGCATTCGCTTTACATTTGGGCTCATTGTGCCTCTTTACGCTATTGTCATTTCCATAATGATGGCCCTAG
TTCTCAGCATCATGGGCGTTAGAGCGCTGGGAGAGGTATGTGGTCGGTGTGGTCGATGTGGTCCTTGCTCCAGCTGTCGA
TTTTGTCCCCTTCCCTATTAACATTGCGCTGCAGACCGATCTGAACCCCGTCTCGGGAATCTCTAAGCTTACACAGCTGT
TCTTCGCACTGATTGTACCTGGATCTCACAAGTACAGTGTTCTGATAAATCTGATTGCAGGTGCCGTTTCAGAAGCCGTA
AGTTTAATCGCATCAACACCCGAGGGAAAAATAGCAAGTAGTGGTAGACTGACACTGTGGCCACCATCCAACCAAGGGTG
CCCTTCAAGCTGGTGAACTGATGCAAGACCTGAAGACTGGTCATCTTATTGGGGCAGCACCAAGTGCCCAATTCTGGGGG
CAGGTCATAGGCACGAGTGTTGGTGCCGTTGTCAGCGCATTCTTATACCGTCTGTACACCACGTAAGTCTCACACGATCT
ATGACTACAAGACTCCACCGCGAATGTCTAGTCCTGATACCGGCTTTCATACTAGGGCCTATGAAATTCCCTCCGATCTC
TTCCAAATCCCCACCGGGTTTGTGTGGATTTTCACTGCTCGTTTGGTGACAGGAAATGGTCTGCCTACCATGGCTGCCCA
GTGGGCAGTTGGTGCCGCTGTTCTTTTTGCTATCCTGACCCTCGTGCGGATACACGCTACCAACAGCCGCTGGCACGCGT
ACATTCCGGGAGGCATCGCCATTGCCATTGGTATGTCCTTTTGAGATTTGCCCCATGGCAACTGCCACAGCAGCCCCAAT
TAACAAGCCAACAGGAATGTACAACGTCCCATCTTTTACTCTTGCTCGGAGCGTTGGTGGCCTTCTGGCTTTATACTGGA
GGTTGTCCGGCCGCGATGAAACTCAGGCCATCGTTCTTAGTTCGGTTAGTAGCCGCAAGATTTCCTCAATACACCTCCCC
TATCGCACTACCCATACTAACTTTGCCGACATAGGGCTTTATCCTCGGCGAGGGATTTCTCAGTGTCGTCAACCTCTTCT
TGCAGAGCAGTGGCGTGCCTCATCTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62