GenePrediction:GLEAN_5378 Details

Name: GLEAN_5378
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:29633..16617 (- strand)
Length: 13017
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:29633..29324 (- strand)
Length: 310
Type: CDS
Source: GLEAN
Position: GCSC_97:29250..29013 (- strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_97:28865..27081 (- strand)
Length: 1785
Type: CDS
Source: GLEAN
Position: GCSC_97:27019..26384 (- strand)
Length: 636
Type: CDS
Source: GLEAN
Position: GCSC_97:25750..25628 (- strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_97:25195..23701 (- strand)
Length: 1495
Type: CDS
Source: GLEAN
Position: GCSC_97:21848..21483 (- strand)
Length: 366
Type: CDS
Source: GLEAN
Position: GCSC_97:21420..21261 (- strand)
Length: 160
Type: CDS
Source: GLEAN
Position: GCSC_97:21174..20885 (- strand)
Length: 290
Type: CDS
Source: GLEAN
Position: GCSC_97:20794..20507 (- strand)
Length: 288
Type: CDS
Source: GLEAN
Position: GCSC_97:20445..20050 (- strand)
Length: 396
Type: CDS
Source: GLEAN
Position: GCSC_97:19839..19667 (- strand)
Length: 173
Type: CDS
Source: GLEAN
Position: GCSC_97:19614..18938 (- strand)
Length: 677
Type: CDS
Source: GLEAN
Position: GCSC_97:18870..17031 (- strand)
Length: 1840
Type: CDS
Source: GLEAN
Position: GCSC_97:16968..16716 (- strand)
Length: 253
Type: CDS
Source: GLEAN
Position: GCSC_97:16637..16617 (- strand)
Length: 21
>GLEAN_5378 class=GenePrediction position=GCSC_97:29633..16617 (- strand)
ATGGGTATCCCGGCTGCGTTCCGATGGCTTTCGAACAAGTACCCGAAGATCATATCTCCAGTTGTTGAGCAGCAGCCTCA
AACTATGGAAGATGGTACTATCATCCCCGTGGACACATCTGGCCCAAATCCAAATGGAGAAGAGTTCGATAATCTCTACC
TCGACATGAACGGCATTGTCCACCCATGTTCCCATCCCGAAGACCGTCCTGCGCCAAAAGATGAGGAGGAGATGATGCTC
GAGATCTTCAGATACACTGACCGTGTTGTCAATATGGTCCGGCCTCGGAAGTTGTTGATGATTGCTGTTGGTAAGCTTTG
TGTTTCTGCATTGGTCGTCTTAAGTCACAAAGTCTAGTTTTTGCTGACGTTAATTTCTGATAGATGGTGTCGCTCCTCGC
GCCAAAATGAATCAACAACGCTCTCGGCGATTCCGATCTGCTCAGGAGGCGCAAGAAAAAGAAGAGGACAAGAAGGAACT
GCTGAAGTTGCTCAAACAGCAGAATGGAGGTGTTCTTCCCACCGAAACGCTTGAAACCGCCGCCAAGAAGGCTTTTGACT
CCAACTCTATCACTCCAGGAACGCCGTTTATGGACATCTTAGCCGCCAGTCTACGTTACTGGTGCGCCTATAAGTTGAAT
ACGGATCCAGCATGGGCAAAAATGAAGATAATCATTTCGGATGCGAGTGTCCCAGGAGAGGGCGAGCACAAAATTATGTC
GTTTGTTCGTTCCCAGCGAGCCTCCCCTGATCATGACCCGAATACCAGGCATGTGATTTACGGCCTGGACGCAGATCTCA
TCATGCTCAGCCTGGCTACGCACGAGCCATATTTCCGTGTCCTGCGTGAGGACGTCTTCTTTCAGGACAGCAAGGCGAGG
ACATGCAGGCTTTGTGGGCAGAAGGGACACGAAGCAAGTGCTTGCAAAGGTGAAGTCAAAGAAAAGGATGGTGAGTTCGA
CGAAAAGGACAAAGAGCACCCGTTAAAGCCATTCATTTGGCTCCACGTGTCTGTTCTCCGGGAGTACCTTGCTGTGGAGC
TCGACGTTCCTGGTTTGCCTTTCCGATGGGACCTGGAAAGAGCCATAGATGACTGGATTTTCCTCTGCTGTTTCGTAGGC
AACGATTTCCTCCCACATCTTCCTGCCCTTGAAATCCGTGAAAACGGCATCAACACACTCACTGGCCTATGGAAGGACAA
TCTTCAATACATGAATGGCTACGTTACTAAGGATGGCCACGTTGACCTTGAACGGGCACAATACATCATGAGTGGCCTTG
CAAAGCAAGAAGATGGTATATTCAGACGCAGAAAGCAGCAAGAAGACCGGAGAGAAGAAAACGCCAAGAGGCGCAGGCTC
CAAGAAAAAAATGGGCGAGGCAATCCCAGAAATTCTGACAAGCCAGGAGGAGATCGCCGCTTTGCCGAAAGCACAGCAGG
GCTGCATCTTCACCCCATCGCAAACTTCCCCCAAAAGCCCACTCCGTCTGTCACATATGACATGGTAGTCAATCGCAGTG
CAGTTCAGGAAGCAAATGTGGCAAACAAAAGTGCCGCCGCTGTTCTGCGGGATCGGATTCTCGCAGCTCAAGGAGAAAGC
AAGAGCGAGACTCCGTCCACAGAAACGGACAGTCCTACTGCGAATGACAAGGTCGAAGCTGGCACTGCGACAACAGCAGA
GGGATCCTCGCTTGCTGCGCTGGGTAAGCGGAAGGCCGCTCTCATGGAGGCAGAAGGTGGCGGTGAGAGCACGCCTGCGA
GCGGCGCCAGCACGCCCAAAGCCGTCGCCTCGGAAGAGGGTCCGGTCGACACTGTACGGATGTGGGACGAAGGATATGCC
AACCGGTACTACGAACAAAAGTTTCACGTGGACCCCAGGGACGTGGAGTTTCGTCATGGTGTTGCACGTTCCTACGTGGA
AGGGCTGGCCTGGGTTCTCTTGTACTATTTTCAGGGATGTCCGTCCTGGGAATGGTACTACCCATACCATTATGCACCTT
TTGCGGCCGACTTTGTCGATCTCGGAAAGATGGATTTAGTATTCCAAAAGGGCCGTATTTCCAGGCCATTTGAACAACTC
ATGAGCGTGCTTCCGGCAGCATCGCGACATGCTATCCCCGAAATTTTCCATGACCTCATGACAAATGAAGACAGTGAAAT
CATCGATTTCTATCCAGTCGACTTTGATATTGATTTAAATGGGAAGAAGTTTGCATGGCAGGGAGTGGCCTTGCTTCCAT
TCATCGATATGAAGCGCCTACTAGCGGCCGTGGAAAAGAAATATCCACTTCTGAGTCCAGAAGATCAGGTTCGCAACGGG
GTCGGGAAGGTTGTCATGCTGCTGTCAGATGCCAATACGGAGCTCTATGACGAGATCACTGGTCACTTCTACTCCAAACG
ACAGGGGACGACCAATTTCAAGCTGAACCCCCGTATCAGTGCTGGCCTCGCGGGCATGGTGGAGAAGATGGAGGACTATA
TCCCACATGGTTCCCTGGTCTATCCCCTGGACCGGAGCGCATTTCCCGATATTGAGTACGATCGGTCACTCACGTAAGTG
TCGAAACTGCACCTCTCTTTCCGGGAGCACAAACTAACCTGGTGTTTTTAAAAGTGTCATCTACGATTTTCCCGCGACCT
CTCACAGCCATAAGTCGATGCTGCTGCGTGGTGCCAAACTCCCCAGCCCAGTGCTCACTCGTAACGACAAGGAGACATTA
ATGGGGAAAACGACACGGAACGGACACAGCTTTGGAGGAATTCAAGGGAACAACAACAATAACAACTACAACGGTCGACC
TCGCTTCAACGGTGGGGGCAGAGGTCAGCAATCCTCCTATGCTCCATCTGGGCCACATTCGCATCATGGTGGACGACCGG
ATCGGTCATCATACCCACAGAACAATCAAGCCGGACGGGGCTTCTACCCGCCACCAGCTACGTCGGGCTGGATACCGCCA
CCCCCAGGATACCCAGGGTTTGGGACAGGCCAACCGCCTCCGCCTCCGCCACCAAGCTATGGCGGTGACGGTGGTCGACA
ATATAACGGCGGTGGGCACTACAATGGTGGCGGGCAGTACAGCGGCGGCGGGAACAATGGGTGGACCCAAGGCTACAATG
GAAATTACGGGCCACCTCCACCACCGGGAAATTATGGTCATCCAGCACGGCAGCCACCAGCGTATGGTGGTCAAGACTAC
CGGCCGGCTGACAATCAATCTCAAGGCTATCGTGACACGAGGAGATACCGGTAAGATGGGACGGACGGTCTTGATGTTGT
GCCACTATGTTTGCGGCGAGGTTTTCATCTTTATTTTTTTCTCTATCTGATCTACCCCCCTCTCTCCCCCTTTTTTTCAG
GGGCTGAGGCTGGGCGACACGCATTTGGGACGGTGGTGAATAGTTGTTCTCTACGACGTAGCTATATACGAGGGTTCGGT
GTTGGGCACAGACTGGGTTCATTTCAGATTGATCTGAAAAGCATGACAGTCGTACGTCGTATATGCCTAATTGACACAAT
GGCTTTTGAGAAGACCTGACTGTGATCATGTCAGCAAACCGAGACATTGCACGCCGTAGAACCAAGCAGGTACTGCAATT
TCAGGCACCGTTCTGTGCGTGTCTGTGGCAGGCCGTCTTGTGTCATGTTTGAGGTCTGTTTGGGCAGGACGACAGAGGAG
ATGCCGACGGAGCTTGCGCTTCACTTTAGCGACGTTTGGGTGCAATTGTCGCGCATATTTCTCGAACTTGCCAATTCCTC
GAATTTTTTTTCGTTCAGTGGACTGCGGGGGGGAGGGTCCAAACACCCCGCGCACTGGTCCCGTCTATGATACACGGACA
AGCAAGGCGCCATAGCTCGGGCGTACACCACACACACGGACAGAGCCAACGGTCTGGACGAAAACGCTTCCAACAACGTT
AACATTGCCACGCGTGAGCTAAAGCACAACTTATCCCGTCCAACGTCCCGCCGACGACAGCGCGTTCCGGGTCGACAGTT
GATCAGGTTGGTGACAGCACAGTTTCTACCGGCTGGCAAACATTCCAACCCTTTCACCCATTGAGAGCCTGCAGCCCCTT
CTCTTCGGCCCGTCACGTTTGGCTAGCAGCATCTTTCCCGCCAGTTGTCTCAACCATCCCCCCATCCAAAGGAAGGCATT
CTCCTTTCACTTGCAAGGCATTCAACGACTTACCGCACTTCCTCTGTTCTCCATCATGATCTCGCCCGAGAGTCGGTGAT
CCTTTCACGTCGACCAGCCATGCTTTCCAGACCAGGCCCTTTTCCTCAGCTCTTTTCTGCAAAATGAACGGCGACGCCGG
CCTCGTAGGCTGTCTCGTGGAGAGGCTTACCACCAGGGTATTGCTTCCTTTGAACTCCCCTCCAATCCTGCCGGCGCCGC
TCCGGTGTGTTGACACGATGCTTGCAGCTACCCCATAGGACCGGAACTCACGGCGATAGTCTTCAGCACGACCAAATCGT
GACCATCACGCGAACGACCCTCGTCCAAGTCAGCTCCACATCTCTCGTCATTGTTCTCGATGCCCTCCTGTCGCTCCTCG
AAGATCTGGCCCGCCCGTACACCAAGAACGTGTCGACACATCCGTCCCATGTTCTGCTGTCCGAGCTGTTCGTGCTGGCA
TTGCTCTCCGACTGCTGTTCCAGTCATTGGGATACCGTGTCTAGAGCCCGGTCGACCGCAGAACAGGGCCTTATCCGGTG
CCGACGACGGGCATTGCATCCGCCTTCTGTTGCTATCGACAGCTCCCTCATCCGCCGAGTGTTCGAGGCCATCCGGATCT
TCATGCCCCCCTTGCCCGAGGGCTATATCCTCCTGCCGAAATCAATACTCGACGAAGTCGAGTCCCAACCTTCCCATGCC
GCCGGCCTCTGGGGAGAATCTTTAAAAGCACCACTCTCAGCACGATCCGAAGAGTCCTTTAACGCCCCACATGTGCTAGA
CTCTCGCGTCTTGGAGATTGAGAGCCATGTCAAAAACATTGTCGAATACATGACAGCTTCCAGCTGGCAGCTGTCCTTTG
AGTACTACAAATCTTCAATCTACAAGATCCGATCGACCGCTCCAACCCAGCCAATGCCACCCTCGAGCCCGATTTCTACT
GACGACGAGAGAGCAGCGCTCGTCCACATTCGCATAGTCTCCTTCTTTTGGTTGGACCGCCACGGGCTTAGCCAAGTCAT
CCAAGAGACCTGCTCGAGCTTTCTTCACTTCCGCAAGCCGTTCCAGAACGCCCTCGCCATATCTGTACCTCTTCTTATCA
CCAGATGGATTTCTCGGTTCCCCCAAGAATTCGTCCAATTGCATTCCTCGCATTTTCGCCTTGATGGAGGCCCTGAGATC
TTGTTCGATATGACGGCAACTGTGACGGACAATGGACGGAGGAAGGGCCAGTTATACCCCTTGCAAACAGCCCTACTCTT
TCTTATTCCAGACGTGTTCGAGGTTGCAAGCAACATGCGAGAGGCCAGGAGCGGTGGTGTCTTAAAAAAGGCCGCCTTCT
TGGAGAGTTTACGCAAGTTATTGCGGAACAGAAATGAACAGGCTATTTACTGTCACGTGGCTCTCCTTTACGTCGCCCGG
CACTTTGAGGCAGAGGGTGACTCTGCCCTCATGAGCTATGCAATGGACGTACAAAATGAAGTCCGGGATGCCATCTTCCG
CAGACTTCCAACCGGACCCGACATGGCTCTTTATGACCAAGAGTTTTTGACAGCCGCCTTTGTCAGTCTGACACACATCA
ACTTTGAAATGTGCGTTGATTCTCTTGCTGAGAGCTGTCTTGCAGCATCCGCACCGCACAACTTCAAAGTTGCCGTGATC
CAGGCTTGCTCGCACTTTGCCAAGCTCGAGAATATAACGAGATATGATCCACTGTTCACGGCAGCTTCAGCCTTTGTGCA
GGTTCAAATGAGGGTTAGTTAATTTCTGAATGGTTCACTTTCGGACTGGTGAGAAAGCAAAAGGCAAGACTGACATAGTT
CTTTTATTTATAGGCTATATCTTCCCAGCTGATGACTGCCTTCGCGGCTGGGCCTAATCCCTTGCCAAAGTCCAACAACA
TGGGTCAATCTATCGCAATGTTATGCAGCATACTCGGCTTCTTGAACTCGTCTCCCCTGACCCTTTTCCAAGGAGCACCC
AGCAAACCTGAAGACCAAGTCGTTTTTTACCGGGAGAATATCGAAGCATTCATGCTTTGCATGATTGTGGCAGACAGTTC
GGTAAGGCAGCTAGCTGTCGGTATCGCACCGCAGCTGTTCTCCAACGAAACTGTTCTGCGTCACCGGAGTTCACTGCTCC
CTTCTTCGAAATTCAAAGTTGGCTTCTGGAAGTTGTCGTAAGTCATCCTCAATCCCTTCCCGGAAGTATCCTCTGTCTGT
TTGTCACTTTTCGGCATTCACTAATACAGGACCCAAGGTCGCGTATCTTGGAAGCTCTGTGTGATTCAGTCAGTCCTTTC
AGCCTCGGAGAGGGACTGCACTCGATTCACAACTATCTTGAGTCCCGCCTTCTGCTATTGCGATCTGTGCAGGTAAGTCA
CAGAAACCTGTTGTTCAGCACAGTCTCGTCAGGTGGTGGTCTCTAATTTTCAAAGGAACTGTCAGAATTTACCGAGGAAA
TTACCGAGCGCACCGCATGCTCAACAAAGCTGGAAACACTGTTTCTTGTCTCACTATGCTCTTCGGAAATCGAGACGTGT
CAGTTGGTGACAGCGTGCATCGGGCTGTTTCTGGATGAGTGTAGCATGATCGACACCGCTTCAAAAGGTGCAAAATCGTC
GTCTACCTTGTTACGCAACGGCGACATATTCCGTGAAATTTCGTCGAGAGAGTTTCGGTTTACCGGCTTAGTCGCGTTCC
AGCGACGGGTCAACGGTCTCTTGAGAAGGATGCAATACCCCAGCTGCGGTATCCTCAGGGCATGGGAAATTGCTTTTGAG
AAATGGCTTCAGCTCTGCAAGGATGTAACGACCGCAGCTCCAGATGCACTTGCCGAGAAAAACATTGTTGCATGGCGAAA
CTACTCTGGATTTCTAACCTCCCTCGGAGGCATCTGCACCGCTGGCCAGGGTGCTGTTATTGAGGAACCTGCCACCAGCG
GCTTTAGATGGATCGATAGGCTGTCACCTGACAACTCCGAGGAGCCGCTGTTGAGCCAATTTCTCAGGCTCAGCATTCAG
CTTTTAGGCTGTGGAAATGTTCGGACCCGAGAGACTATGAGGGAGGTGTTGTCGATGGAGAGCTCTCCAATACTTTATCA
GCCGCTCTTCAAGGCTCTACTGGCGGAGCTCGACACGTTGTTCTCTGGCGCAACAGACCATACCGCGAAGAATCCGGACA
GTGATGTTGCGTTTGTAGAACAGGCAGTGTCACTCCTTCGTTGCTTGATAGAGCGATTGGACTCCCCCTCCGACGACTTG
GGAACAGCATGGTCTGTTCATCTTGGGGCACAGACTCTCAGCTTTGCCAAGTACTTGGACACATTGCCCGACACACCAAA
CAGTCTCCGGGTGAAAGTTAAGACGTGCCAGCTCTGCGAAGCTATGACCAAAAGGAGAGAGCACCTGAACCTACGCGATG
ATGTGCGCATTAGAAACCAACTACTCGAAGTCATATTCAGCTGGATTGCGCGTCCGCATTCCCCAAGCGAGCACCCGTAC
GGCGGAAGCACGGGCCGTCAAGATGAGGCTGCTCGACTACAACGAGATCTAGACAGGGCATGTCTACGAGCCTTGGCCGA
GCTCACTCACCGACTACCTCTTCAGCCTGGAGATGGCCAAACGGACGCTGGAACAAGTGACCTGAAGTCGCACATGTTTC
ACACATACTTCAATCGGTTTCTCTCTTTGCTGAACCTGGAACAGTCTGAATCGAGTCGAGCAGAATACGGAGGCGGCAGT
ATCCGGGATGAGACAACATCTTCGTCGGAGCTTGCTATCACCATCCTCTCCAATCTTCTAAGCTCCAATCTCGACGTTGG
GCTGAAGCGCTCTCTCAGCATTGGATACCATGAGAATGTAGAAATCCGGACTGCCTTTGTCCGAGTTTTGTGCAACATTC
TCATGCAAGGTACAGAGTTCAGCAATCTCTCTGACACGGCAGTCAACGACAAATACGACGATTTGATGGAAGTAAGTGAT
CGGCCTTCAAGTCTACGTGCCAGATTTCGATCAGGATCTAACAAGTATCCTAGCTTCTCACGAACGACACCACTCTAGCC
ATGGCAATGTCTGCTGAATGTCCCGGTTCTGAGGTAGATGAGCTGACGGTTTCGCTCCTCAATGTGTTTGAGGGCCGCGG
CCTAGGCTTTGTACTTCTCGAAGCACTCATCAAATTGGAAGTGGACGAGACCGGTAAGCACAATCGGGGAGTATCTCCGC
CGACTTTTTTTCTAATTTCCTTGAGACCATACTAATCTCAAATTATTTCCTCATTATAGAGAACGAGTCTGAGCTTCTTC
GACGAACCTGCGTTGCCACAAAGATGCTTTCGGTTTACGCCAAGTGGAAGGGTGGACCCTATCTCAGAGCGACATTGCAG
AAGGTTGTCGAACGACTGATGCTGACAGCTGATGACCTTGACTTTGAACTCGATCCTGCTCGTGTCAAATCCCAGGATGA
GCTTCAGAAAAATGCGGTCCAACTTCAGATTGTGGCCAAAGTATTTATCGATGACATTTGTATATCAGCAGCCAGAATTC
CGACAGAGTTTCGCAGAATTTGCAGCATAGTACGTGCATACGCCAAGAAATTGTCTTGGCTGCTATACCTTTCCTTTCCC
CTCATCGGCACTCCTTCAAACTGACAGTCCTTGTGATAGATTTCGTCGGTGGTGACAACTCGATTTCCTGAGGCGAAGTA
CACAGCCGTGGGAGCCTTCATATTCCTCCGATTTTTCTGTCCTGCAATTGTGGCACCAGATGTGGAGGGCCTGGTATCTA
CAGTGCCTTCGAAAGAGATGAGACGGGGTCTTCTTTTGATAGCCAAGATCATCCAGAATCTAGCCAACAACGTCCTCTTC
GGAGCAAAGGAACCGTACATGTTCCCCCTCAATGAGTTTTTGTCACAAAACATCTATGACGTGACGACCTTTTTAAGGAC
AATATCGGTATGTTGATATCTGGTTCAAACGTACTTGAATGTGTTAAAAGCATCCTAACATTGAGTAGGTGGCTCCCAAC
ACCATAGAGAAGCCCACGGAGGGCGAGTCGGTCGATTTTGGTGCCTCTGTGGCTCTACATCGCTTTTTGTACGACCACTG
GGACCAATTACGGCAACGACTTGCATCACAGGAGCGCCGAGATCACGTCCGGTCCCCTGGAGAGGGTCCTCGTGCCCGCT
CTCCGACCCTCGAAACAGTGAAGAATCTCATTACGAACTTGGGGCCACCTCCATTAGCTGTCACATGGAACAAGCCGCAG
ATTACGCTCAATAGTCCGCCGGCATACTCTCGATTTCAAAACTTCATGCTGCGCAATACATTCAGGAGCACTGAGTCCTA
TGTTACAGCACGCGCCATTTACGATGGCGGCGAGAGCAAGGTATTGAACTCGTACACTGGCACGGTCTACTTGGCAATCG
ATCTAACCCGACTCTAGGATGGCGTGTCTATCATATGCATCATTTTGCGTAATATAGACGCTGAGTCGATTGACTTTGAC
ACTTTGATCTATTGCTATCTGAAGGCTTGTACTCCCCGCCCCTGTTTCCCTCACATAGTCGGAAGCTCTCTCATCGTGCT
CTTGGAGCAGTAATCTGACCTGCCACACCTGCAGATTGCCAGTCGTCTCTGGCACAAACCGTTTGGGCTTTTCGTCGACG
CCACGTGTTACAGCGGACAGAATGAGCCGCAGGACGATCTTTTCCAAAAGTTGGAGCTCCTCACGCCCACAGAGCTATCG
CGGCAGCTGTCTAGGGTATACATTTACAATATGAACAGCGCTTTCCGGTGCGTCACCATCTAGAATTTGCACTCATCCCG
GGCTTTCTAACGGCAATAGCAAATGTTTCCGGCGAACTCTCCGCACAGCAGCGAAGTTGGATGGCGGTGTCTTCCACCCA
GATAACGTCGACTATCACCTCATTAGCAGCATGCAAGATTTGCAGGCTCACTTCCATCTTAGTCAGCTTCATCTTCCCAA
GGAGACTATCAGTGTCGTGGCCGATACGAGATATGTCTTCCAGCAAGTCACGCGGCTGTCTCGATCGAGAGGAGAGATAG
ACGTCATTATCAAAATCGGCAGCCAGTTTGTTCAGATCACCACAACTGAAAAGCAAGAGATTCACCAAGGCTTCGGCCTT
GAAGCCATCTTCAACGACATCTTCCGACTGTCAGACATTGAACAGGCACCATTGTCTGTCCAGGCGGACGACGACTCCGC
TTTTGGGTTAAGAGCCGAAAACGGGAAGATTGTCATGTACTTTGCGAGCCCCAAGAAGTCCGATATCCTGCAGGAGATAA
GAGGAGCCAAGGCAAAGTACGGAAAGGATTACAGGACCCCCAAGCCCTACAGCAGACTGGTGCGCCCTCAGGATGTTCCC
GGGACGCTTCTCAATATATCCCTTGCAAACCTGGCCAGTTCCGACCATGCCTTGCGGATGTCGTCGTACAACTTGCTCAG
TGCTCTCTGCCGGTCGTTCAAGTTTGCGTCTGCCTCCAAGCTGCTGTGTAGCAAAGGTGAGCTCCATCGATACAGCCATG
ACCAAAGCAATGCCTTGTCCTTTCAACTAATTGTCTCCGACAGACATTTGTGTGCCGCTGGATCCGTCTCAGTTTGTTAT
CAATATCAGTAGGAAACTGGCACAAACAGAAGCGCACCTCACGACGGATTTTTTGATGGCATTCTTCCTCAACTGGGACA
GCCTTCCGGACGAACAGAAGCCATTGAGCCTCGCCTATATGGCTCCTTGGCTGCCCGGACTGCGCACCACCGTACTGACG
GCAGAGACAGAAGGCGAGAAGGTGAGGGAAAACATTGCAATGTTCTGCAGAAAGCTGGTGGACGTTGCAGTGTCGGATCC
GTTTTTGAAGTTCACAATCGAGCAAAACGTGTGGCCGGCAATTTACCAGGACGAAACTCTGCTAGACATGTTTCTAGAAG
AGGTTGTCAAGATGGGAATATCGGCTGGGATCAACGACGAGCAGACGGAAAGCCTTGCCTCGGTACTCGCGGGCATCGGC
ACAGTGACGCTGCGTGGGAAGATCATATCGCGCCTGAGGAAGGCTCTCAACCGATCGTCGGTGCGTCCGACGAAGCACCT
TCCGGACAATGCCGTCTGGACGGAGATCTGCGTGCTTTTGCAGTTCTGTGTCTCCCTGTCCTTTGACAACGGCATCCAGT
CGCAGCTCTACCTTCCCGAGATATTCCACATTGTCACCATGCTAGCCAACACTGGAATGTCGGGAGCACGCTTTTTGGTG
CACCGTCTGCTGACGAATACGATCCATGCCATGTGCACCTCGTTCTCTCTCGACGAGGTGCGACTCGGAAAGCTGAGAGG
GACGTTGGAATCTCTGTCAGAAGAACGGGGCGACCTGTTCTCAAATCACACGTCGTTCGGCCGAGACGGAGCTTCGATCT
CGACAAATCAAGACGCTGGAGCGACGCTGGTGGCCACTGAGAGTCTTGCGGCGATCCTGTTTGAGCTGTGCTCGGTAGCG
GCCCCGACGATGGACACGGCCAATGCGTGGCGTGCTCGGTGGATGAGCCTGGTGGCCAGCACGGCCTTCCAGAACAACCC
AGCAATTCAGCCGCGGGCATTTACGGTCATGGGCTGTCTCGCCCGCGAGGAGGTGGATGACGATCTTCTGTACCAGGTGC
TCGTGGCGCTTCAGACCAGCATTGGGCGGTTCGGCGATGACAACAACAAGGACATGACGGTGGCAATCGTGGCGGCACTG
TCGAAGATGATGGCCAAGCTCTCGTCGGCGTCTCGGTATGGCCTCCAGCTGTTCTGGTTGGCCATGTCTCTGCTGAGACT
GGTGCCGTCGGGACTCTTCAACTACACCGCTCTATTCTTAGAATCCGTGCTGGCCAACATCAGCGTCTCGGGGGAGATAC
GCGGGGACCACATGGTGCCGCTCCTTCTTCAAGGCCGCTCTCAGCTTGAAGACGCGGCTCTGCCTCTTGACGAGACGTAC
GGGATCCACTTTAACAGCGACAACTTCCATTTCGCAGTCTGTGCTTGCCTTGTGCGCGGCCTAACAGACGCGACCACTCG
ACCGGCGGCTCTGCGGCTGCTGTCTACGTTCCTGGAGCTCAGCAGCTGGGCCCAGGCTGGGCGGGAACCCAAGGCAGCGG
ACCTGGCGGGCTCGCCGTACATGGCACTAATTCTGGCGCGTGCGGGAAGCGCGGAGGAACTGCGCGACAGCCTTTGGCAC
CTGGACGATGGCCAAGCCGGGCTGCCGAGCCTGGCTCAGGCCCACTCGCTTCAAGACGTGGGACGAATTGCGGAGAAGGA
TCTGCTGCTAAACACGGCGATGGAGCTAGTCGATTTCCAGTACCTCGAAGATCCGATCCAAAACCGGACTCTGTCATGGT
TGAACGAACTGGCGCGGGAGAAGCCCAACGTGATCATGCACCTGTAAGTTTCCGTCCATCTGGTTCCGGGCAGACCAGGC
CGGTCAAGCAACTAACGAGAGGTAGATGTGCGCCCATCGCCTCGATACTGGACGAGGTCTTGCTGCACTGTCAGAACTCG
TCGACGCTCGAGTCGGCACACGAACTGTTGCAGACGCTCAGCTCGAACCCGCGGTTGTCAAACATGCTGGATTCGACAGA
CATGTTAAAGGCAACACTGGACGACCTGGGTTTCGGAGGTCTGTGGCGGTCGTGCTCTTTCAGCAACCCCCACGAGCAGG
ACGAGCGTTGCTTCAGCCTGACAGAGAAGCTCATAGCGGTAAGCAGTTGCAGATCGCGCCGATCTACGGTGGCAACAGAG
CGGATAGTTGGATCTGGTAACTAATGTGGCCCACAGCTCACTATTGCATACTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62