GenePrediction:GLEAN_537 Details

Name: GLEAN_537
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:481765..484612 (+ strand)
Length: 2848
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:481765..481884 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_97:481999..482244 (+ strand)
Length: 246
Type: CDS
Source: GLEAN
Position: GCSC_97:482576..482675 (+ strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_97:482814..484612 (+ strand)
Length: 1799
>GLEAN_537 class=GenePrediction position=GCSC_97:481765..484612 (+ strand)
ATGTCCTCGGCCGTAGCCGAGCTAGAAGCGGGGTTGCAGGCCATGCAGGGTCTCAAGCCGCCGGGCGTGTCAGGATCCCG
CATCACAGCCTTGACCAGCCTGTGCGTTGCAAACGTCCAGGTAATTACCAGCTGCTGTCCCATTGTATTTGATGATAAGC
GAAACAAAAAATCACACACCACATCGCATAAAATGTTGCATCTGCTGACAGGCACCTTGCTTTATCGCTTCTAGTCCGAG
TCCGTCCTGATTCAGAAGCTCTACACGCATTTCAAGCGGACACCAGGCACACACAAACTCGGTGTTCTCTACGTCGTAGA
TTCTGTAACCCGCAAATGGCTGGACCAGGCCAAGCTGCAGGGTCAGGCTGTCAACAGCTCAGCACCAGACGGCACATATG
CTGCGGGTGTGAATAGAGTAACTGAACTGATTCCCGTCCTGATGAATGATATATTGTCGTCAGCGCCGGCCGACCAAAAG
GTACGCATATTTGCCATGTTTGATAAGAGTGGAAGAAGGGATGAGAAGCGCGAAGCAAACAGTTGTGTCGTAACCGAGAC
CAGCGAGCGGGCTTTGCTTGGTGGGTGGCTACAGGTTCCTCTGCCGCCTGGTTGTCCTATGGCTCGGGGAACTGCAGCTT
GCCAAGTAGCCGCTTTCTAGCAGGGACGTAAACGCGACCTAACTGCTCTGCCGTTCCCGGCTGCCGTTTCTTTTTTCGGG
CTATCTCTGCTGCCACTCTTCCTTCTTTTTCGAATGCTTGTTCTACCGCTTTGCGTACCGTCTACTCACACTTTACTTTT
CTTGCCTGTAGGAGAAGATCAGGAAGCTGGTCGACATTTGGGAAAAGGGCCAGACGTTTCCGCCCAAATTGATTGAATCC
TTCAAGGACAGATTGAATGCTGCCCAGCCAAGTAGGTCCTACCATCAGCCTTGTCTCCCACACTTTACGAATTATGCCCC
GGATATCCGGAGCAGCTCGTATTCGCATAACCCCTCGTTCTCGCCCTCCTATTCGTTCAATGCCCATGCTCCCAAGCCTA
ACAGTGTAGATTCATCAACGACACCACCTGGAAGTCCTCCATCCAATGTTTTGGCGCCCTCAGCGGCCCCCCGGCCTGAT
GCTGCGGCTGGACCACCGGCGATCCCGCCAAACATTATGGAAACACTAGCCAGCATTGCGCGGCAGAGCTCATCAGCAGG
AAATGCTGGTCCGACTCCCGGGCTGACGGCCACGCCGCCGAACATGTCGGCTCCTTTCGGCAATGGGCCCAACAACGCCA
ACATGCCCCAACACATGGCGAACCAGATGCCGGCAGGCATGTCATATCCACCGCAGTCGATGCCTTTTCAGATGCCGTCA
GCACTGTCGGGTGCAGCAGCGCCGACGCCTCAGATCTCCATGCCGTTTCCCACGCCTGCTGCTACCAATCAGATGCTGCC
TTCGGGCTTCCCTGGCCTGGCAGCCGGGCTTAACACAGCCGCTCTGCAGCAGCAACAACCACAACAGCCGGCTGGCGGCA
ACATGCAGCAGAACCTGTTTTTCATCCAGGCGCTTCTAGCTCAGGGCTTGTCGCTGGACCAGATTTCGGGAATCCTAGCA
CAGGTTAACGGTGACGGACCAGCAGCTCCGGCGGCCCCGACGTCGCTGGTCCCTGCTGCGCTGGCAGCAGCCGTGGCAGC
GGCCGGAGGAGCTGGTGGTGCTGGTGGTATGCCACCGGGATGGCCGCAGAACAGCAGTGCCGGCGGGTATGCCGGAGCGG
GAGCTCCAGACTGGAGCAGCAGTGCAAATGTACTCGACAGATTCGGACGGCAGTCTCCTAACAGGGGACGCGGGCGGTCG
AGGTCGCGGTCGCCAGGGCGGTATTATGATGAGCGGGGATCTCCGCGAGGACGCGACGAGCGTCGATCGTCTCCGGGTCG
CGGCGACAAAGAGCACCGTGAGCGAGGACGGGGCCGGGAATACCGACAGCGGTCGCCTGCGGGTGGACGGCGTGGTGGCA
GCGGCAACGACGGAGTGAGCCCACACCGGGAGCCGCCTGCACCGACAGAGAAGTGGATTGAGCACGACGCATCGCTGCCA
CCGGGATCGATCCGGGTGCTGAGCCGGACGCTGTTTGTGGGTGGTGTGACGATCTCGGAGCAGGAGCTGCGGGCGATCTT
TGGGCGATTCGGTGCGGTGCAGACTTGCATTGTCAACAAGGAGAAGCGACACGCGTTTGTCAAGATGTACACGCGCAAGG
ATGCAGAGCTGGCGCGCAGCGGCATGGAGTTGATGCGGTCGGACGACTCGGGGCTGCGGACGCGGTGGGGTGTTGGGTTT
GGGCCGCGCGACTGCAGTGATTACTCCAAGGGCATCAGCGTGATTCCGATTCCGAAGCTGACCGAGGCCGATCGCAAGTG
GTTGTTGACGGCGCCATGGGGTGGCAGTGGTGGACGGCAGATCGAGCCGGGGATGGTGGTGGAGGAGCCGGACATTGAGA
TCGGCGCGGGAGTGTCATCCAAGGCGATCAGCCGGCGGATGCAGACGGATCGAGGCGGTGTCAACGGGCCACGGTCAACG
CGGCGAGAAGAGGAGCTGGCGGCAGCAACAAAGGGCAGTCACGAGGGCGGAAGTGGTGGTGGTGGTGGCCGTGGGACGAG
ACGGGGAGGACGTGGAAGCGGTCGGGGCGACGATCACGGCGGCAATGGCGGCAATAACGGCAGCAACCAGCACAATGTTG
TTGGTGGCAGTCAGGAAGCGCCGAATATGGGTGCATTTCCGTTTGGGTTGACGATGGGTCCAAACGGGATGCCCGTCTTT
CCTTCCGGCTTCCAGTTCCCGGCGCCCAGCCAGAGTGGCAGCCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62