GenePrediction:GLEAN_5381 Details

Name: GLEAN_5381
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:1025322..1024840 (- strand)
Length: 483
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:1025322..1025115 (- strand)
Length: 208
Type: CDS
Source: GLEAN
Position: GCSC_132:1025057..1024840 (- strand)
Length: 218
>GLEAN_5381 class=GenePrediction position=GCSC_132:1025322..1024840 (- strand)
ATGTTCACTGCGAGACGCCTGTTTTCTTCAAAGGCCACCTTTGCCGTTGCAATTGGGGTACTTGGCTTGGCTGGATTGAC
AGCCGCCGCTCCCCTTCAGAAAAAGGATACTTGTACCTATACCTGCGGTAGCATCTGCTACGATCAGTCTGACATTGATG
CTGCCTTGGATAAGGGCTATTCTCTCTACCAGTCTGGGTCAACTCTTGGTAAGTTCTCGGTTTTTTCCATCCCTGTTTTT
CTATTGCTTATATTGTGCTGTCTAGGCAGAGACAAGTACCCCCATAAGTATAACGACTACGAAGGGTTCAGTTTCCCCAC
ATCATCGCCGTGGTACGAGTTTCCCATTCTATCGAGCTACGAAGTTTACACCGGTGGCTCACCGGGAGCGGACCGTGTAA
TCTTTGACTCCGAGGGCCAATTTGATAGCCTTATTACACACACGGGTGCTAGTGGCGACGACTTTGTCGCCTGTTCGCAA
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62