GenePrediction:GLEAN_5382 Details

Name: GLEAN_5382
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:1018480..1017102 (- strand)
Length: 1379
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:1018480..1018274 (- strand)
Length: 207
Type: CDS
Source: GLEAN
Position: GCSC_132:1018183..1018149 (- strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_132:1018072..1017751 (- strand)
Length: 322
Type: CDS
Source: GLEAN
Position: GCSC_132:1017677..1017102 (- strand)
Length: 576
>GLEAN_5382 class=GenePrediction position=GCSC_132:1018480..1017102 (- strand)
ATGGCCAGCATAACGGGGCTCGAGAAGGAGAACCACCAGCGCGATGCTGAGTTCAACAAGGCCCTGCACGGTACATCCGC
GCAGGCTAAAGGTGGAGTGGCCGCGATGTTCACGAAGGACCGTGAAGCAAAAAAGCTCGCAGTGGACGAATACTTCAAGC
ACTTCGATAACAAGACAGCTGCGGAAGAGACAGAAGAAGACCGCAAAGTATGGCTTTTTCTCTTGGGGGTTGCCATTTGG
CGTGGTACGCGTATGGCAGTTGTGACGGAGGAGGGCTGACAACTTTGACTCGGACAGGCTCGCACCGAGGAATATGCCAC
ATTGACAAGACAGTACGCAAAGCTCTGGACCCATTCGTGGTCATTCCAGTTTCTTCCCGTGGGCAAGCACTAACAAATGG
CTACATAGGTACTACAATCTTGCTACCGATCTCTACGAGTACGGCTGGGGCCAAAGTTTCCACTTTTGCCGCTATTCAAT
CGGCGAATCCTTTTATCAGGCCATTGCACGTCACGAGCATTACCTGGCGCACAGCATCGGCATTCAGGAAGGGATGAGGG
TTCTTGATGTTGGTTGTGGTGTTGGCGGCCCAGCCCGTGAAATCGCAAAGTTCACGGGTGCAAAAGTCATCGGCCTCAAC
AACAACAACTACCAGATTGAGCGGGCCACGCACTATGCGGCCAAGGAGAAGCTGTCTGACCAGGTGGCATTTGTCAAAGG
CGACTTCATGGTTAGTTCTAGCCCCGCCTGTTAGCTGCATTATGTGCTGCATTATGTGGGGTATCCTAACCGGTCGCGCC
TAGCAAATGTCGTTTCCCGACAACTCGTTCGATGCGGTATATGCAATCGAGGCGACAGTGCACGCGCCACGTCTGGCCGG
TGTATATGGCGAGATCTTCCGGGTGCTGAAGCCGGGTGGCGTCTTCGGTGTCTACGAGTGGTTAATGACGGATGACTACG
ACAGCAACAACGTACACCACCGTGATATTCGGCTAGGCATTGAGCTGGGCAACGGTATCTCCAACATGGTCAAGATCTCA
GATGCCCTGGATGCTGTGAAGTCGGTTGGCTTCGAGCTGATGCGGCATGAAGACTTGGCTACTCGCGATGACCCGCTACC
TTGGTACTGGCCACTCGCTGGCGAGATGAAGTATCTGCAGTCATGGGGTGACCTGTTCACGATTGTGCGCATGACACATG
CTGGCCGCTCGTTCATGCACGGACTTACAGGACTTTTGGAAAAAGTTGGCATAGCCCCGGCGGGCACGAAGAAGACGGCT
GATGCGCTGGCAGTTGGCGCCGATTGCTTGGTGGCCGGAGCGCGTGAGCATCTCTTCACCCCCATGTATCTAATTGTTGC
ACGAAAGCCGGCGAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62