GenePrediction:GLEAN_5384 Details

Name: GLEAN_5384
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:1005860..1004163 (- strand)
Length: 1698
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:1005860..1005752 (- strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_132:1005682..1004625 (- strand)
Length: 1058
Type: CDS
Source: GLEAN
Position: GCSC_132:1004552..1004163 (- strand)
Length: 390
>GLEAN_5384 class=GenePrediction position=GCSC_132:1005860..1004163 (- strand)
ATGAGCCGGAGAACTTTCGAAAGCCCAATGGACTGGGAATACCAGAATAGTAGCGGGCCTCTGGATATGTCCAGTCCCTT
TTCCCAAGTACCTCGCCAACCGTTCGGCAGTAGGTTGGGCACCTGTCCACCCCCTCCTTAATGTGGTCGTTTCTTTTTTG
TGTCCTGACCGCTACCAGCCTCGTCCTTTGGTGCAGCCTCGCCCTCACGGGCAACCAAGTTGACCAACCCCTTCGCATCG
AAGACCCCGAGCGGACTCTCACAGCCTGGTCCTCCTTCACCGTCAAAACAATTGTTTCCGAGGCCGCCCAGCTCATCCTT
TTTCAAGCCGCTCGCTGCAAGGCAATATCCAGCGGCGTCAGCGTTCCGCAATCCCTCCTTTACAACTCCCCAAAAACGGC
CTGATGATGCCATGTCTGAGTACTCGGGCGCCGAAGAGAGCCCAGCAATGGCCAGCGACGTGTCTGAATTGCCGGGCGAC
ACACCGGACGACCACGAGAGATATAGCCAGACGCCTGCATCAGCAGTGGGTCGCAGACTCTTCTCGGAAAGAAGCCAGTC
TGTGTCAACAACTACAGGTCATACCCCTGGCCGCGGCGAGGTACCACGAGGCGCTTTGGAAGCCTTCTTCAACCGGAGGG
ACAAGGTGCGGAAGCGGAAGCGACAGATGGGAGACAGGGATGTTGGCAGTGTTCGAAACCGCTTCAACGCAGCCTATACA
TCTGATGAAGAAAGCGACGACACAGACATGAGCGAACGTACCGCCGGGGACAGGCGGGAAAGACGGCTCTTCAGCAAAAA
CAAGCACTCTACAGACTATGCTTCCGGGGGGGCAGATCGGGGCTTTATTGGCAATCTGTTTGCGGCGATCCATGAACACC
CAAATGTGCCATTGATCTTGTCGTGGTGGGTGCAGCTGGGCATCAACGTCTTCCTGGTCTCGGTCTTCATGTGGTTCGTA
TGGGGCGGTATCTCGATGATGCGCGCAGATATATCCTATGCCGCAGATGCCGCACGATCAAGGCTCCTAGCAGATATGAA
CGCTTGCGCACACGAGTATACCAAGAATCGGTGTGCGCCCAAGACGGAACGGCTGCCGGCGCTGAATGTGGTGTGTGACG
AATGGGAGGTGTGCATGAACCAAGACCCATCGAGCGTCATGAAGATGCAGGTGTCGGCCAAGAACGTGGCCGAGATTATC
AATGAGTTTGTTGGTGCTATGAGTATCAAGGCATGGGTGCGTGTGCTCTCTCCATATAGTCTACTTCCACTTGTAAGCAT
GTAAGCATTGCTAACATATACCTCGCAGGGCTTCATCATATCAGCCATGTTAGCCATGGTGCTTGCCAGCAACCTGGGCT
TCAGCCGCTTCCGCGAGACGGCCTTTGTGAGCCAAGCCAGCGGCAATGCAGCAGCACACCGGCCATATGCATCTCAGCCA
GCCGGTGCCCCAATGATGCCAGCATCCCAAGACCCAAACCAGGCTTATATCTGGGCGCCCATTGGCCAAACACCCCGGCA
TATTCGCCGAGAATTCATGCCCGGCACTCCCACAGATACGGAAATGTCGCCAGATGCACCACGGGCGGCTATCATGGCAG
CACCCCAGACACCATCGTTCCGACGGAGTCCTAGCAAGGGTGAGCGGAGCCGGAGCCCAACAAAGGTCAGGTACCGCAGC
CCAAGCAAGGGCCATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62