GenePrediction:GLEAN_5385 Details

Name: GLEAN_5385
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:998350..995458 (- strand)
Length: 2893
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:998350..998090 (- strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_132:998033..996856 (- strand)
Length: 1178
Type: CDS
Source: GLEAN
Position: GCSC_132:996765..996647 (- strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_132:996579..996345 (- strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_132:996277..995458 (- strand)
Length: 820
>GLEAN_5385 class=GenePrediction position=GCSC_132:998350..995458 (- strand)
ATGGACCCAATGGACCCAATGGACCCAATGGACCCAATGGAGGACGACACCCCGTCAGGGCCTCCTTCGATACCGACTCC
TGCCACCATGAGCACAGGCAGCCAGGGCAAACAACCGGCCGTATGGGAGCCAGAGCCAGACCTCCAGTCGCCCTCATCGC
TCGACGTGCCTGCTTCGCAGCAGCAGCTGTCCAAACGGCGTCGCGGTATCGGGGTTGTTACGCCCAACGCCTGCAACGAG
TGCCGAAAGAAGCGTGTCAAGGTTCGCAAACACACCCCGACGCTCTTTCAGCCCGGATGCTAACCACCCCCTGACAGTGT
GATGGCCGCAAGCCGTGCGGCCGGTGCAGGGCTCAACGGAGCGTCGCCTGCGTCTACGAGCTCCCGGTTCGCCAATCGAA
AGAAGACCTGCGAAACGAGATCGAGAACCTGCGTCGCCGTCAACGCTCCAGCGACAGCGTGCTCTCGGCTCTTGCCCGAC
CCGAGCTTTGGGAGGAGGTGCTACAACGGCTGCACGGCGGCCAGTCGGTCGACGATATATCCGAATGGCTGGACGGGGGT
CTGTCCCAGAGCCTGCACGGGTCGCAGGTCAGAATGCCCACCACCGGCATTCTGCCACCGGCATTTAGCAACCACATGCC
ACCGGCATTTGCAGGCGGTGGCACAGTCCCCTACACGCCCTTTTCGCCTGGTGGCCTCACGCCTAGCGGTGCAGGAGGCA
GCAGCTCTACCGGACCCGGGTCGCTCCGAAGCCAGCTCGATCAGCAGCAGCCGACACAGTCCCAGGACAGCCTCTGGGCA
AACGAGCTGTATCCGGGTCCCGGCCAGGCAGCCTCGACCAGCAGCAACTCTCGCCAGGACTGGACCCCGAGCGCGCCATC
CCAGTCCCGCGTCGGCTCCTGGGCTGATAGCAATAGCCCCTCGGCTTCCTCTGAAGGCCCGTATCGTGGCCTGGACCAGA
TCCTTGCCCCTGCTGCCACCGGAAGGAAGGTCCCTGCAAGCAGCTGGACAAGCATCACCAACGACTCCCATCTTGTGCAG
CATCTTCTGGCCCTCTACTTCTGCTGGGAGTATCCCACGTTTGCCTCGCTCAGCAAGGAGCATTTCCTCCAGGACTTCCA
ACACGGATGCGAGCGGTACTGCTCACCCATGCTGGTCAACGCCCTGCTGGCTCTGGGCTGTCGCTTCTCCACACAGCCAA
ACACGCGCTCCAACCCGGATGATCCCTATTCCTCTGGCAACCATTTCTTCAAAGAATGCCAGCGGCTGCTGCAGCTCGAG
TCGAACCACCACTCCTTTACCACCATTCAGGCCCTGGGCATCATGTCGATCCGCGAAGCCAGCTGTGGCCGTGACTCGGA
GAGCTGGTACTATGCTGGCCAGAGTATCCGCCTGGCCATCGAGATGGGACTGCATCAGGTCCAGTACGAAGACGGTGATG
AGGAAGAGGCTGCCGTGCAGGCCGCCACCTTCTGGGGCGCCTTTGCCCTTGACCAGTGAGTTATCTCCCCTGGTTTGTGC
TTGCTTCGTGTTGTAGCCATGGACAATTCCAAATTCTGATCAGTCCGAGCGACTTTTCTTCCCAGTGCGTGGTCACTCGC
TACCGGATCTCTCCCACAGTGCTCATATTTTCTCACCCTTCCACCAAAGCCCGCAATCATTGATGATATTGAGGCATCCT
TGTGGATTCCCTACACCGATGGAGGTAAGCAGTTTGACTCTTGCCGCTCGTCGCGTCGCTATGGTTTGTCTAATCCCGCT
ACACTGCATAGGTACACCCCTTTATCAGTCGAGCCAACAACCATCCAACGTCCGGTCTGTGTACACGTGCTTCTGTGACC
TGAGCGAACTAGTCCACCGATCGCTCTATATCCTTCATACACCAGGACGCCCTCTCATCAGCCGCAACTTGCTCGGCATG
TACACGCAGTATCTGAACTGGTACGACTCCATCCCTGAGGCCTTGCGGCTGGGTCGCAACTTCACACCAGCAGTCCTCTT
TGCACAGTAAGTACCCGGACCTTCATCTCACCATACGGACGTGGTGGAGAGTCGTTGACCATCTCCGTGATAGTATGTAC
TACCATTTTGCGATTTTGCTGCTCTTCCGGCCTCTCATCAAACTGCGAATCATCGGGTCCAGCATCTTACCTCGGGATGT
GTGCCTGCAGGCTGCAGATGCCATCCAAGGTCTGCTGAGGTCGTACTCGCAACTATACACATTGCAGAGAACGCCATCCT
TCGTGCCATACTTTGTGCTCACTGCATGCATCATGCACCTTGCCATCGGGGCGTTTTCAAAAGACTTCGACTCGGCCATG
CACGACCACCATGCAGCAGGACCGCCGGGACCAGAGCTGGATTTCGCTACCGGACAAGACGCGGTCGAGAATAGCAAAAG
GGCGGAAAACCGTGGGCATCGTATGCGACCTGTGCATAAACTGGACCCAAGAGTGGTGGAATCTATCAACCGCGGCATCG
CAGACCTCACAGAGATGGTTCCATGTCACCATTTTGCCGAGCAGGCTCTCAGCATATTACGATTCCTCACCAAGAAGTGG
AACATCGATGTGCACGTTTTGGTTGTGGCCAAAACGCCGAGCGGCGATATCGTGGAGGTTGAAAATACTCGTACAGTGCG
GCCAATGACCAACAGCCTCAACTTTTTTGCCCCAAACATGGAGGAGAGTGACTTCAATAGCACTTGGGGCAGCTTGGCTG
ACGGAGTTTCCAAGACGGTTTCCACAGCGGCCAGTGTACTCCCGGCGTCGCTAACCAGCATGGCGAGCTCGGAATGCATA
GAAAACCCTTTGTTCTGGCCTTTTCCTATGCAAGGCCGGCCGATGCTAGAATCAGGAGAGAAGTTGGAAGCGGCCGGATT
TGCCTTGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62