GenePrediction:GLEAN_5386 Details

Name: GLEAN_5386
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:991725..990018 (- strand)
Length: 1708
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:991725..991512 (- strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_132:991456..990018 (- strand)
Length: 1439
>GLEAN_5386 class=GenePrediction position=GCSC_132:991725..990018 (- strand)
ATGGCCACAGAAACGCCCTCCGAGCCGCGCGGCCTGACCACCAGCGGATTGCCTCCCGACAGCCTGGCTGCTGCCCGACA
ACACATTCAGAGCCTCCCGGCACACGAGCGCGAGGCGCTTCTGCGGGCTCTCCTCGAGCAGTACGAGCTTCAGGCGCAAC
CGGATACAGCTCCCGGACCCCTGACCTTGCGCAAGGAACTCGTCGTCCGGCAAGGTAAGTCCGATCCGCTCTCTGGGCTG
TTGCTCTCACGAAGCTGACTAGAAAGCAGTTCCGGCCGCTGTAGCACCCCCAACGCCTCCGCCTGAGATCTGCACAAACA
CCTCACGGTCTTCGATAGACACTCGCGCCTCTTCGCCTCTGCCGGCTGCAAGCCTGTACAGCCAAAGCCCAACCCTGGTC
GCCTCTCCGCAGACAGACGAATCCTCGTCTCCCTTCTTCTCGCATCTCCGAGTCAAGTCTTTCTCCCAGCCGCGCCGCTC
GCTTTCCCGACCGGAATCGAAGCCACGGCAGCGGTCAGACAGACACAGACGAACGCTCTCTCTCCCTTCTGAAGATATGC
CTAACCCGACGATATGCGAAAGCGGGTCTTTCCTTCCGCCGCCTCCTTACACTGTTGATGATGAGGATTCTCCGCTCGCC
GATCTTTCTGCACCGAACCCTACAACAGAAACAGCTGCGTCTGCTGTCTCTGATCCCGCGGCCTCATCGACGACCAATCC
ATCGGCCAGCACCGCCCGTCCCAACACCGCCGCCGCCTCCTCCACGCGCGCGTACTGGTGCACATCTTGCACCAGGAAGT
ACCAGCGACGGGAAGACTGGACTCATCACGACGAAGCCTGCTGTCGCCGCCGTCGGCATCGTGCAAAGCAAGCGCAGACG
CAGCAGCAGCAGCGCGCCTGGGCTTGCGGCTTCTGTGCCGCCTTCCTTGGCTCAATCGATCGCTACCACGACCATGTGGC
CCTGCACTTTGAGAACGGCAAGACGCCCGCACACTGGCACTACGCCCACGTGATCTACGGCCTGCTGCATCAGCCCGGTG
TGCATGAGGCCTGGAAGCGCCTCTGGAACGTCCGCATGGCCGCCCTGCCCGCCCGCATGCGAACCAAGGTCTACTGGCCG
CCCGAGACAGAGGCCCGCGATGCCCAGGGCTCTCGTCCAACCCTACAGGACTCGCTCGAGCTCTTTGATCTGGCTCACCA
GAGCGCAGAAGTGCTGGCCACGCGAGCAGACGCCCTGGCTGTCTTTGTCACCGTGCCTATCGACGAGCCGGAGCCTAGCT
CGACTGCATCTACATCTACCGCTGCTGCAGCTTCTTCCCACGACAACAGCCTCACAATTCCTGGCTTGACGCTAAGAAAG
TCGAGCAAGGGAACTGGCGCAAAGCAACCCTCTCGAAAGACTGTGGCTGCCAACGATCCACTTCAGAACACTGTCCGATC
TGGCCGGACAGGGCTGCCGCCTGCCATAAACCCCCTGGCCTTGTCGCCAATCAATTTCGCGCGGTCACTGTCTGCTCGGC
ATACGAGCACATACAGTGATGGAGGCAGTGGTGCGGGCCTCGGCATCGGGCTTACTCCCCCCCCAACCAGACGACGGCCA
CATCATCATTTACATGCCTATTCGCTGGCCGAAGAGGCCAATTTTCCCCCTACGATAGGAGAGGAGACAGAAAATCTTTC
GTCAGACTTGTCTTCTGCGTTCCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62