GenePrediction:GLEAN_5388 Details

Name: GLEAN_5388
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:985789..984558 (- strand)
Length: 1232
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:985789..985397 (- strand)
Length: 393
Type: CDS
Source: GLEAN
Position: GCSC_132:985344..985302 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_132:985218..984899 (- strand)
Length: 320
Type: CDS
Source: GLEAN
Position: GCSC_132:984827..984558 (- strand)
Length: 270
>GLEAN_5388 class=GenePrediction position=GCSC_132:985789..984558 (- strand)
ATGCAACTCACAAATCCGGCCAACCTCGTCTTCCACCGGGAGGGTGGACTGCAGCTTACAGACAGGTTCAAGGACGGCGA
GTGGCCCGCCATAAACCCGGAGGACTGGAAGAAGGGGGGCACACCCATTGCCATCACATTCTCTAGTGGCTCCCTCTTGG
AATCGCCAATTCTTGTTCTTGAGCTCGTCCGACGAGAAGGGGACGCCACCGGACGGGTTTACACGGATGCTGCGGGTCTA
CACCACTGGGTCCATCTGCCGTCTTACGGTGTGATCGACCCAGAGTCGTACTTGACATGGCTTCGAACTAGAATACCTGA
GCAGGTGCGAGCTTGGGCAACTACAGCGAGCGCTGCTCATCGGGAAGCCCTTCGCCTTGCGGACTCGGGCCTGGTACGTA
CAGGTCTATGAACCAAATGTGCTGTCTATATACTGACAAACGTAGGCACCTGAGCTACTCACGCTTTTAAGTTACGACTT
TGGCAGAAGTTAGTTCACTAACAGACGGATGAGAAGTCCTATCGCGACATCTTCGAATTCGGCTCACAGCTAACCACCAG
CACCTGCACAGACCAAAAGACGCGCTCTTCATATCTCACTGGGGCCAACGATCTGGGAATACCACCTCTGCCGAGAGATT
CGCAGACACTGCCTGGACGTATACCCCTGCCTCGCATTGTTACAGCACAATGCGATAACATATCGTCCATCTACCTGGCC
AGTCTGCTTGAGGAGCTCTTCGGCGATGGCAATGGTGCACTGAGCAAGAGGCTTCTTTCCAAAGCCCCTTTAGACACACA
CATTGGCTATGTTGCCCTCCGCATGCTCATACAAGGCACCATCTGGATTTTAGTCGATAAAAAGCGCCGTGATGTGCAGA
ACAACACAAACGTACGCTGCCAAGGTTCCTCAACGCATAATGCACATACCTGCCCGCTTTCACAATGCTTACACTATTGC
AGGACCCTTCGTTGGAGGTGCGTCTTCAAGGCAATCTTCAGCTCCTTGTATCCAATTTCATCCAAGTTCACCGCGGAACA
GTCAGCTACAGCCTTGTCAGACAGATCCTTTCAAGAGAGGGGATGGCCTTTCACGGTGGCATCGAGGCCGAGAAACAGCT
CGATCAAATTCCAGAAACAGATTCCTGGAAGAACGCGCTATTCTGGCTTCCAGCGCTCGAGGATCTGCTTGTGCAACCCC
ACCAGGTTCGCTTGGCATTTGGGCTCCGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62