GenePrediction:GLEAN_538 Details

Name: GLEAN_538
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:493626..494242 (+ strand)
Length: 617
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:493626..493704 (+ strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_97:493767..493895 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_97:493965..494242 (+ strand)
Length: 278
>GLEAN_538 class=GenePrediction position=GCSC_97:493626..494242 (+ strand)
ATGAAGATCAACTGGCTCCTCATCCTCCGCGTGCTGCAGTGCGCCTTTTCGATCATCATTCTCGGCCTCTCGGCCTATGG
TAAGTTTGGCCCCATGCTGGGCACTGCATTGTGCTAACTTGTTTCTGCCTCTGTCTCACAGTCGTCAACTGGTACAACAC
CGACATCCTGACCAAGTCGCCCACGCAGGTTAACTTCCTCGTCGCTGCTCCGATCATATCCATCCTCTCCATTGCGTATG
CCGAGATCGCATCGCGATTCGTCAAGCAAAGTAAGTCCAAGTTCAGGCCAAGACTTCGACACGCAAGCCGCTGCCCACGC
TGACATGCCGGGCAACCAGTCTACAACCCCTACGTGGCCATCGCTTGCGACTTTGTCAACGCCATTCTCTACTTTGCCGG
CTTCATCGCTCTGGCCGTCTTCTTGAGCGGCCTGTTCTTCTGTCGCGGGACCGTGTGCGCGGCCGCGCGCGCCGACACGG
CTTTTGCCGCCTTCTCGTGGGCTGCCTGGATCGCCAGCACCGTCTTGACCGGCGTGGACATCTTCAGGACCCGCGCGAAC
AGCCCGACCACGCGGACGCGGGTCGAGATGAAGCAGGCTGCAACAAGCCAGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62