GenePrediction:GLEAN_5390 Details

Name: GLEAN_5390
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:974875..972975 (- strand)
Length: 1901
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:974875..974447 (- strand)
Length: 429
Type: CDS
Source: GLEAN
Position: GCSC_132:974294..972975 (- strand)
Length: 1320
>GLEAN_5390 class=GenePrediction position=GCSC_132:974875..972975 (- strand)
ATGTCAGGTGACGATTCTGCTTCTTCTACCCACAGCCAAGGACTCCAAGCAGAACCGGTTCAGACCTTACTTCCATCCGA
TCCTACCACCGCAAAGAAGGCTGGCACCAGGTGTGAGGAGCCGCTTTCAGAGGCGGCCAGACGAGTCATCCGAACTCAAA
AGACTGGAAGCGGCAACTTGTTCCGACACCTGCACAAATTGAGTCAACGAAATATGCGACTCTTCCAGCCGGCTCGACAA
TTAGCAACCAAGAGCAAGGGAAAGATGGCTGATAAGCCGCCTGCAAACCCGGGAAAGCTCCCCACGCTGCAAGAAATGTA
CAACTCATGGCGTGCCTTGGAGGAACAAGTGGACGGAATACACAGACTCCCCATGTTCATCAGGGCAGAGCGAAGGGCCT
GCCACAGATGTAGAGTATTGAGGAAAAAGGTATGCTCACCCCCTAGACAGCTATCTTCCGGAAAGTAATAAGATTGGCTA
AGGTGTCGGCTTTCTCTCAGTGTGCATGCTTCGACTATTCCAAGCTAGAAAAAGGATATCAAGAAAGAGACCTGGCTCTC
AAACAGGCCATTCTTCACCAGTGTCCCTTTCCCGACGAGTATGGGGCTTCTCCCAAGCCCACATCATATAATGGAGAAAC
CTCCTCCCACGACGCAGTCTCATCGCCCACCGTAGGACAAACTACCCTAGACGAGTGCGGAAAGGGTGCGGCACTGTACA
CCCAACGGTGGACTCCAACCGAGCACATTTTCCAGAGCTCGCGCGGCCGCGAGATTGACGAGCATGGTCGCCCCATCGAT
GATATTTTGCAGAGTACCCAAGGCATCGACCTGACAGCCCACGATAGCTTCAGCACGCCGCTAGTTGCGGGGATTGACGG
AGACGCAGCCATCAGCGGTGCTGCCTCACAACAAGCGGAAGTGCCGAAGCTCATGAAGGTTGAGATTCGCACCGTTCTCA
TTGCACAGGAACGAATCAGAAACAATGTCCGTAGGTGGCGGTGCCAGTTCGGCAGCAGCGGCATGCCCGGCGGCCACGTC
TGTATGCGTGAGGACAACAACCTCAACACCATCCGCCGCCACTACGGACGCGAGCATGGCAAGCACCGCTACTACATGAA
ACCGAAGATGCGGCTTCGTTGCAGCCACTGCGGGCACACGATCGAGAGCAGAGTGCCAGACCATTGCCCTGGCTGCAATG
GGACACGAGATGCATGGGTACAGGAGGTATATGCTCTCATTGAAGTACCGGTACCTCTGGACACAAGCAGCCCGGCAGAT
GACGGCGCCAATGCTCTCGGATACCAACAGACCGGAGGTTTGGCATCAAATCCAGTCGCTTCCACAGCGTCTTCCCTGCG
ATCTACCATCGCGGCGACGGCAGCGCCATGGACGGTGTGCAATTCGTTGGCTTCTCCCCTGCAGCTGACCTCTGCCGCCC
GTGAAACCTCCACAGTCATGGCTCTTTCGGGTGGCCTGTCCAGCACTCCCTCAACTCTTGGGCTTCCATTAACGCCCTTG
ACTCCTCTGACACCACTTACGCCCAACTCGCCAGCTTCTGCTTCTGGTGATGTATTCTTGGGCGACGCAACAGCACTGTT
CCCCTACGGTCCTCTGGACATTGTGGAATGGCAGAAGGACCCTCTGTTCGTTGACGGACTGTCTCAGGAACAGCTGTTTT
ATGGCGACGGAAACCTGAGCACCGCCATTGGCTGTGGCATCGATATCGGTCTGGACTTCGACCTGGATGGCGCCTCGGCA
TCCCAGACATATCCTTCATATACGACGAATGGAACCGAGGACATGGTATGGGCGACGCAGAGTAGCGAAATCTACGGAAG
CCAAGAGGAACAGCCGCAGAGAGAACATTGGGTGCCAATGATGGAAGACACGATCAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62