GenePrediction:GLEAN_5392 Details

Name: GLEAN_5392
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:968826..968237 (- strand)
Length: 590
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:968826..968819 (- strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_132:968742..968554 (- strand)
Length: 189
Type: CDS
Source: GLEAN
Position: GCSC_132:968486..968237 (- strand)
Length: 250
>GLEAN_5392 class=GenePrediction position=GCSC_132:968826..968237 (- strand)
ATGCGTGAGTACGTGGGCCCTTCTTGTCATAATCTCACTCACAGAAACACAATTCCATTCCCCATTACATGGTCCACACA
CAAGCGTGGGCGAGGCGTCCCAGAACGTGAACACGACGTGGCGCTGCATCGATCAAGAAGACGATAGAGACCACCAAAGA
CACGACATTGGCGTGTCTAAAGACGAACACTGCCAGCTTTCCACAAAGGGAGAGGAAAGCAACGACATGCGTGGCTCAGG
ACGAGGCCCGACGCAAATCGGCATATCGTGGCAGTAAGCACTCCGGTCTAGGACAGCAGGCAATAGTTTTACAGACAGCA
CTAACTATCCACCTAGCGAGCACACTCAACGAGGTAGAAATAGCAATGACCGAGGCTCACATGGTGGCCGCGGTGGTCGT
GCTGGCTTGCATTCAAGAGGCTGCAAGCCTGGCGATGGAGTTGATCTGGATGGCTGTGACGGTGGCAGCCCTTTTCTGGG
GAGTCGTGGTAACAACCGTGGTCGTCGCCGGGGCCGGGGTCGCGCTGGTTGTGCTTCTGCTGCCGATCCTGGCCACCCGG
CTCCTCCGCGAGAGGCCCACGGGGCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62