GenePrediction:GLEAN_5393 Details

Name: GLEAN_5393
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:968111..965937 (- strand)
Length: 2175
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:968111..967140 (- strand)
Length: 972
Type: CDS
Source: GLEAN
Position: GCSC_132:967019..965937 (- strand)
Length: 1083
>GLEAN_5393 class=GenePrediction position=GCSC_132:968111..965937 (- strand)
ATGCCCAACAAGACGCATCATACACAAAATATCAACACAAAGACAGCATCGACAGCGACAGTCACAACGGCAGCAGCAAA
GACGCCCTTTACAGTCGCGACCTCCGCAACCTCCACCACAGCGAAGGCAATCACTACGACCGCCATAAAGACAATCAGAC
TGGCAGCCATCCCGCTTCGACCGTTTTCTGCCTTAGTGCCAAAGACTTCCAGTCCTGCGACCGATGTAGAGCTCAAAGCT
CCCGCTCTGGCCGCCGCTGTGGTCACCGATGGAGTCAGTCATGAGAAGAACCGGCGTGCTCGCAGGGCTGAGAGAGCCGT
TCTGATATTCCGTGAGCAGCGCCAGAAGCAACAAGCTGAAGATGCGGCACGCCGCGAACGTTCTCAGACAGGCGGCCTTT
ATCCGGCGCCTTCACTGGGCTGTTCGTCCGATAGTGTGTTGAGCCCGTCATCTGCTGAAAGCAACGGCAAGAAGACAAAA
AATGTCCATTTTCACACTGGCCCCGCTAACTTGACCGCCAACCGTCAAACACTCATCAGCACCGTGGCAAATTGTGCGTC
GCCGACTGCGAGCGCTAATACTGTCATCGCCTTAGAGAAAACCCCGTCGTCGAAAAAAATGCTGCCAACGCCCTCTTCAG
AGCTAGCAGAAGTCATATCAGTAGCAGGCTTTGGCCAGACGATGGACAGTGGTGTTGATCAGGGCGTCGTGGCAAGCATG
AAGAGGAAGAGCGACATCGCTCTGATGGGCAGCGATGCCGAAGAGGGCAACGAGTCGGACGAATCAAATGCCAGCTTTAT
AATGACCCGAACTGCTGGCAAGCGCCGTGGTAATTTGAGTAGCGGTGACATGTTGGCCAACGAGATACTGCACGATATCA
ACGAAGATCTCAATACCATGGCGGAAGAAGCCGAGGAGTGTGACCCCATCAAACGTTTGCATCGGGGCTATATGAACGAA
GCTGTTGCTATGGTGCGTTTAAACCCTACATGCCATCTGTTTTCTCAGCCGATGAATCGGATGGACGGCACAGTCCTCCT
CTTAAAGGTTGCATCGGCATTTGATGTCTCAACTAACACACCAGGCTCATAGGCTCAGTTAGCTTTGCGGACGAATGAGA
CCCCTGTCGGCTGTGTTCTTGTTCACAATGGTCGTGTCATCGCCAAAGGCATGAATGCGACTAACATGACTCGCAACGGG
ACCCGTCATGCTGAGTTGATGTGTCTGAACGCTCTGTTGGCGCAATGGGACGATGTCAGCGATGTTGATTCGCGGCGTGC
CGATGATTCCGATTGCGACAGTGCTCAAGACTACGACAACGACACGGACGAGTTCACAGACAGAGACTGGGCCCGGGTCA
ATCCAAGCAAAGGGCACCTCTTTCCCTACGGTCAGAAACTGCACCCCGCTCGTGTCGTCAATCCGGACATTGTCCGTGGG
TGCTCCCTGTACGTTACCGTCGAGCCGTGTATCATGTGTGCCTCAATGCTACGCCAGTACGGGATCAAAAAGGTCTACTT
TGGAGCCGCCAACGACAAGTTCGGAGGCACCGGTGGTGTGCTGCGCATTCACATGAACTCGAAGCCTAACGAGCCTGCGG
CCCAGAATGCCACCTACATCGAGACCTATGTTACCAACATGATGTCGAAGCCACGACGCACGCGGACGGTTCGCCAACCC
CTCGAAGGTACCGGAGGCAGCACATCTATGCCCTCGGACAAGGGTATGCCTGCTGACTCGTCGTCGGAATTGGATGGCCC
TCCTATGAACAATCCGCCCATCGTGCGCCGTGCTTCAACTATTCCCATTGCCGAAGGTTCAGTCCCTGCTAGAGACTCGG
GACATGGCGGAAACGTCGAGCCAGGTTTTGATGTTGAAGGCGGATGGGGCCGCGATAAGGCAGTTTTTCTCCTTCGGCAG
TTCTATGTTCAAGAGAACGGTCGGGCGCCGGCGCCACGCAAAAAGGAGGGCCGAGCTCAGCGCCTGGTTGAGCAGATGAA
GAGTGAGAGTAGTAGTAGCGTTAAGCTTCCCTCGTCTGTCAGTGGTCATCAAGCTGAGATGGAGGTGGAGCTGGACTCTC
TGCCACTGGAAGCGTCATCGCCGTCTCGTCCTGTGGAAGGGCCATTGGGGAGCATGGAAGTGGACATGAGCACGGAAAAT
GCCTTGACCGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62