GenePrediction:GLEAN_5394 Details

Name: GLEAN_5394
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:965855..963154 (- strand)
Length: 2702
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:965855..965703 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_132:965210..964797 (- strand)
Length: 414
Type: CDS
Source: GLEAN
Position: GCSC_132:963860..963713 (- strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_132:963632..963154 (- strand)
Length: 479
>GLEAN_5394 class=GenePrediction position=GCSC_132:965855..963154 (- strand)
ATGGCAGCAGACACATGGAGACCACGGAAGCACGCAGATGCTGGTCCCGATGACGTCCGCAAGAAGAATCACAGCAACAA
CGCGGCCACCGAAAACTGCCGGGGTGATCTTGGAGAGGTTCCTGCGGACAAATACGATGCTACGTACAACCTTGTTTGCG
CTTCTACGGAGGCGTTGAGCACTGTTAGCAACAACAGTTCGGCTGCATGAATTTTGGGCGATGGCCATGTACCGTTGTTC
ATTTTAGTCGATTGGGGGAGCCTAAACGGGATGCACCGCCTGGATGCCGCACACGTAGTACGCAACAGCAACTAGGATTA
TGTAGGACGGAGGCAAAGGGAGTTCTGTATGGAAACCCGGTTATACCGGAAGACATGTATGTTCTGCGGACATATCCTCT
TGATGCAGCTTTCCCAGATAGCAAGATACGTCAACATGGCGTAAAGTTCCTGTAACTCTGGTCCTCCTAGATGAAGCACG
ACTCCTCTTATAACGTTCACTACGATGTATTTTTTACTACATTATAGGGCGTTAGAAGGTGAGCCAGTCTTGCCCCTGTG
CTTATACGTCCAGCTGGAAAAGACGCCACCACACGTACAGCATATCAAAGAATCAGTCAAGAGCTGATTTCGTACCAGTC
TTTAGGCTTGCCACAAGACTCTCTGCTCGCTGGGCTGCTCGACCTCGACGGCCACAGACGGCTTCCTCGGCAAAGCTGAC
GCGGGAAGTGCACCAACTGAGTATGGATTCGGCTCGGGAAGCATGGTCGGTCTGGTGGAAGAGGCCGACGCTGACGTCGA
CGAGGTCAGGACGCCATATGTCGTGCCAGAAGACGGTGGCGCTGCATCTGGAACAGAAATTGCGCTCGACTCCTGGGCTG
GAGCTGTAGGTGGCGAGACGGCCAAGGCGCTGGATGTCGGGATCGGAGAAGTCGAGGGAGCGCGGTGCTTGGTGGTGGAG
AAAGATGTTGGCGCGCGGCACAAAGGCCCAGGTCTGGATCTCAAAGCCGGAAGACAGGCGACAAGATCGACAGGCGCAGG
TGCCGGCAAGATAGCGGGTGTGGGGAGAGGCCGAGGCAGTTTGAGATTGAGACTGAACCAACCACCACTTGTCGTCTGAC
GGATTCGCGATGACATCCGGGGCTGTGGTGGCAAACGGATGGATCAGGTCGCTGAAGCCCGAGTGTGGCCGACGGCTCTC
GACCGGGTAGCGGTCGGGGTGCCGCACGGTGAAGCAAACATTGCGGCAGTGACAGGAAGCGAAAATATCGACGGGACCAA
CGAGTGACGATGGGCCCGGCGAAGTGGTGTCAGCAGGCAGTCCTGCCATCGGGCGGCCGCTGATGGAAGGCAGTCACACG
GCCAGACCGCCGTCCTGCGTGTCGGTGACGTGGTCATGACGGACAAATGCCAGGGTGGCAGGTCTGTCAGAAGAAGCAGC
ATCTCCGATCTCCTCGACGATGACACCAGTGGCTACTTGCCACTGGACAATTTCGTCCGCTCCTCGATCCCGACGGAAGA
CATGACAGCCACAGGTGCGACAGAAGTACCTGGTGACAGCAGCAGAAGAAGCATAGGCGGACAAGGATGCGAGAATGTGG
TCGGCAGCAGCAGGCGGCTCTATCGGACAGTACGACGTGCAAAGCAGGCCGCTGGAGTGGCGGCAGGCAGTGCAGTGGCA
CAGTGCGAGTGGGACGACGGACGAATCAGACGTCGAGCTGGTGGTGACATTTTGGGCGACAGCGCCACAGAGACAGTCGA
TGGCGAGACGGAGGGCCATTTTGGGGGAAAAGGTGTCGATGCGATAGAGGTGTCTGCCGCGGTGGCATCATCATCGTCTT
ACATCTCGTCGGCTCCTTCATCATTGGTCTTCTGTTGGCGTGGCTGAATTCTCCCCAAATGGAAAGCACCCTCTGCTGAG
CTGCCGTTCCCCGCAATCCACTCTTTTGACACACGACAAAGACGCGACGCTCCAATGCCTTCACTACTTTTGCAGTCGTC
GGCCGACGGAAACGGTACAGCCCCCTTCGCGCTGGCTTCACAGCCGCGTCCACGTCCCAGTCGGTCGCCTAGACAGGCTG
CACGAATTCGGGTGCAGAACCGGCGGCTGGAGTACCTGCGGCGCAATCCGTCGTATGTCGAGAGTAGCGATCGCGAGTTT
GTCGGCACGTACCCGAAATTCCACAAGTGGACCTGCTCTCCTGCATGCTGACCGGCTGGACAGACGTGCAGCTGTACCAC
GAGCTGGTGCGCGCATTCCAGACGCCAGACGAACGGAGAGCCGAGGCACGCGACAAAGGTTTCGGACAGGTGTTGGAAGC
GTCTATGTTGCGGAATCCAGAGCGACTACATCGAATAGGCGAAGAAGAGGAAGAGGAAGAGGAAGAGGGTCATGGCATTG
ACCAAAACGACAGGGCCACGGCTGGTGACCTCGACCTAGATGATGAAGACGGCAGCGATGCGACATCGCCGCGAGATGCA
GCCAGCCGGCGCTGGCAGGCAATTGTACGCAACTGGTTTGTGAGCGGCGGAGCGTCTGCCGACGGCTTCGACTACGTGAC
AGTGGACGACGACAGCGACTACGACGTGTTGGCGCGAGCCGATGCCGAAGAGGCCTGGTTCGACGACGAGTCGCCGGGAT
GGGCAGATGCCGACGACGACGACAGGACAAGGACGGGAGACACGGGCGTGCAGGACTATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62