GenePrediction:GLEAN_5395 Details

Name: GLEAN_5395
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:962946..959252 (- strand)
Length: 3695
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:962946..962731 (- strand)
Length: 216
Type: CDS
Source: GLEAN
Position: GCSC_132:962547..962514 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_132:962252..962147 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_132:962077..961304 (- strand)
Length: 774
Type: CDS
Source: GLEAN
Position: GCSC_132:961253..959252 (- strand)
Length: 2002
>GLEAN_5395 class=GenePrediction position=GCSC_132:962946..959252 (- strand)
ATGCGGCTTCGCCACCAGCTTGTCGCATTCTCGAGGTATAGGAGCCCTCTGGACGTTAATGCCATTCGTAGTCATGGAAT
GTGCTCGAGCCTGCAATACGAGTACGAGCAGGCTAGTCTGCCAGGCCAAGACAACATCTACGATGCTCGATCGGCAGATA
TGCGTCGTCGGTTCTACTTCAAGTACGGGGCGCTCCATACAGAACATACAGAGACCGTCCAGACATCGTGAACCAAGGCA
ACGTCTTCTGCAGTCTGCGTGATCTGTGCAGCTTCCTTTCTCGTCCTGACCCCCCGGAAAATAAGGTGGTTTCAGTCCGA
TTCTACACCGTGGTAGCGCGTGTTTAGCGCCTGGCACCAGCTGCGTCGATCCCTAACCACCCAATCATCTCCCCTGCAGT
GGACGCTGGGCCCTGCATTCTTCCCACTACGGAGTACGTCGTCAGTCCCCCTCCTGTCCCGCATTTCCTGATTCTTCAGG
GCCGCCAGGTGGTCCTCCTTCTTAGCGCGCAAGCCATTGCGTACAGAGGGCTCTCTCCTCTTACGAGAACGCGACGGGCC
CAGGGCTCGTAAATATCTCTGCTCGCAATACCCGTACTTGCTGGAGAGCCACCACGACACAGAAGGACAATCGACGGCCT
GTCCGAAACTACCCTCTCAAAAGCCACCCGGCTGTCTTTCTACTCGCCACACAGCCGAATTTCCGCTAGCGAGCGCCATT
TCGCCGGCATCTCTTTCCACCATGGCCGAGGGCAGCTACGGCAGCAGTCCCTTTTACCGGTCGGCCGTGTCGTCGCCCAC
GTGAGCAGTCCCTCTGTTGTGGCTGTTGTCCTGCTTCTTGCGCTCCTGCTGACCACAGTCGTCGCCCAGGGAATCGGGAA
CGGTGACAGCAAACTACAAGGCCAACGTGAGCCGGAAGAAGACGCGGAAATGGGTCGAGGCCAAGACGATCAACTACGAC
GGCAGCGGCTGGGGGGACGAGGACGACGATGACGATGGGGATGACGACGGAGCCCACATGGCCGGCGGTGTACCACCGCC
GATGCCCAGTCTTCCCGGAACCATGCTGTCTGGCATCCGCACGCTGCCGTCTATAGCTGGTGCCAGTGCAGCCGCCAGTC
CGACGACGGCGACACATCGTCCACGACAGGACTCGCTGCCGACGCGGCCGCTGCTAAACGGACAGACGGCAGCAGCAGGA
GAGTCGGCTTCGACACAGCCGCCGTCACAATTGCCGTCCTTGCCGTCCCAGCAGTCCTGGCGCCAGGGCTCGCCGGCGCT
GCCGTCCAACAGCCAAAGCAATAGCAGCAACCGGAGCAGCAGCATCGGCACGCCGGCCGCTCGCACTCTCTCAAGCGTCC
CGTCCTCCAGCACCGCTCCTCCGCTGCACGCCGAGCTGCCGCGGTCTGGATCCATGCCGCCAGCCGCCCGACGCCAGCCT
TGGACGTCCGAGGCTCGCTCGCAGTCGCCTTTGGGCCCGCGTGCACAGTCGCCGGCTGCGGCCGCTGTTCGTCGAGCTGC
CACGGCCAATGCCAGCGCTCTTGCCAACGGCAGCACCAGCAGCCTCGTTCGCCCGTCGGAAATCTACCGGCGTGGTACAT
CCAGCGAGGAGACCGTGCCACAGCAACAACAAGCGTCATCAAGGTGAGAGATGCTCGTCCTGATGACATCTGATTGGAAT
TGACTTTTTGCAGTCCAGGAAACAACGCCACCGCGGTCGCACCTGCCGCCTCGGCCAACATTCGATCACCAGAAACACCC
GTCCGAGAAATCGCCGCAGCCGCAGCTGCAGCCTTCCAGACTCCCATCATCATAGCACCCTCACCTGGTCCCCATTCTCA
ACACAAGCCAAAGGTCTCGACTGACTCGGCTGCATCTTCTGCTGCCAGCACGGCCGCCGAAGAGGAGGCCCGTCGGTTCT
CCAACTTCCCTAAGCTCCCTAGCCTGGCCCGCTTCTCGACCTTTGCTCCTGAGCTGCTCTTTGGAGAGACAAGCCTGCTC
TCTTCCGATGGTGCGCCTCCTGTTCCGGCCCTGCCACCGGCCGCAGGAAAGGTAGAGGCAGCAGCCCCGCTGGCCGTGGC
GCCCACAGCGGCTGCCTTGTCGGGTGACGCCAGCACAAAGAAGCTGGCCGACATGGCGGAGGTTCCCGGAGATCGGTCCG
AGGTTCTCCTAGATCGTGTCGCTTCGCCGCCGCCGCCGAGCACCGTGGTGACCCCGACGGCACCCCTCAATCCACACCGG
GGCGCGCTGCCGCTTGCTGACGGCGTGCCGCCGCCGCTGGCCACGACCACGCTCAAGCGGTCCGGAACGAACACGACAGA
ATCCAGCGGCACAGTCGGGACGCCCAAAGAGAGCGACAAGCTGCACGAGGAGATCATTCGCACGCTGACGCCGGCCAATC
TGGCGAGCGGGAACGCGAACGCGACCACGGACACGGCTGCTGGCGAGCAGTCGGACCGCGAGGATGGAAAGCTGACGCGC
GAGAGCTCCTATCTGCAGAGCGTCTACGACGAGTACTGGACTGCCGACGACGTCGACGACGCCTCCGCAGAACCGGTGCC
ACCTCTGCCCCACGTCCCCATGTTGACGGCGGCTGCAGCAGCGGCAGAGGTAGCCGGAGCAGCAGCCCTGGTGGCCTCGG
GCTCACAGCTTGAGCTGGGTGGGCAGAAGGCTGAGCAGAAGGCTGAGCAGAAGGCTGAGCAGAGCCCGGAGCTGAAACCG
GAGCCGATCCCGGAGCCAATCCTGAAGACGACCCCTACCCTGTCAACACCAGAACCGGCAACGCTGAAATCCCCGGCTGT
CTCGCCCGACGCCAGGATTCGACGCCGCTTCTCGTGGGAGGGCGAGTCTCAGGCCGCGTCTCGAGCAGCGTCTGCTACGG
CATCTGCTGCTGAGGTCGATGGCAGCTCAGCGCCTGAGCCAGCTCCTCCGTCATCGGCGGCAGCAGTGCGGATGTCGGTA
GAGCCACCAATTCCGGTGGAGCTGGAGGACCCTAGATCGCCGGCATCTCTCTTCAGCGCGTTTGAGCTCCACACGCTAGC
GACAGAGGCGCCGCCAGTCGATGCAGACTCGGCCCCAGAGGTCGTGCAGTCGACCACACAGCCGGCCCTGCGATCGATGT
TGGACGTGGTTGCAGACGAGCCGAAAGCACCGGCCATTGTCGGACTGCCGGTGTCTCCGCGACCGCCGCACCAGCGACAG
CCGTCGGCAGCGACAGGCCCGAGAGAGTCGGTGCTGTCGGCGCACTCGCACTCGTCCACACAGTCGGCGCAGTCGACCCA
GCTGGCCCCGTCGGCCCAACTGATTGGCGGCTACGGCCAGGACGAGGGCAACAGCGGCCAGCTGCTGACGCTGCGGCAGT
GTATGGCCTTTGAGACGCACGAGGAGCGTATGACCAAGCTGGCCGAGACGCGGAGCGAGTACGCCAACGCAGACTCGGGC
CTGCTCGCGTGGCTCAGCGCCATGACGGCCGTGCCCGAGTACGCCCGGGCGTCGTATGTGCCAATCTGGGAGACCGTCTC
GGCCGGCCAGCCACCACCATCCCGACCGGCGGCTGCACTCGCCAGCATACCGTCGATCCCGTCGAGCAACCACATCTCGC
ACAAGGGCAAGGAGATCTTGGCAGCCACAGGCAAGGCCGGCAAAGGGCTCTTTTCCTTGCGGAAGAAGGGCTTCCACAAG
AAGGCGGCCAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62