GenePrediction:GLEAN_5396 Details

Name: GLEAN_5396
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:957603..953323 (- strand)
Length: 4281
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:957603..957534 (- strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_132:957455..953323 (- strand)
Length: 4133
>GLEAN_5396 class=GenePrediction position=GCSC_132:957603..953323 (- strand)
ATGGGCGAGAACAAGGGAAAGCGGCCCGAGAGCGGGCCACCGCCGCAGCATCCGGGAAGCACTGCACAGGGTGCGTTGAA
GAGAGGCCCGGAATGTGGTGCATTTTGTCCCCTTTTTCCAGACACTGACCGTCTGTATTGTGCACCAGCTCCCGACTTCG
ACCAAGCCGCCAGCCCGTACGGACCATTTCCTGGCATGTCTGGGCCCATCGGCAGCCCTAGCCAACAACGGCAGCCGTCT
TGGGGAAACCGATCCCCGGTGGTGTCGAGCCCCCAGCAGCAGCAACCGCCACAACAAGGTCAGGCTGTTCAACATCAGCA
GGCATACCGTGGTCAGGGCAGCCAGGGATCGGGAAACCAGAGCCAGGTCCAGTCAGGGCCGGGCCAGTACCAGACGTCTC
AGCAGCCGAGCTGGCATGGCCAGCCGGTTGCGCAACAGATGCCACAGCAGAAGCAGCCTGTGCAGCAGCCTGTGCAGCAG
CAGCAGCCCTTGCAGCAGAGCGCGCCGTTTCCCATCCACGGCCAGCCGGGTGGCCCGCAATTCGTGCCCGAGGGAGGATG
GAAGCTGAAGGAGTCTCATCTGCAGGAACCGCTCGCGTCCACGCGCCAGCGATCGTCGCCCACGACACCCACGCAGCAGT
ATTACGGCCTCGACAAGGAGGCCGAGCTGCTCTCGGCCGAGTCAACCGCTGCTAATACCATACAGGGCACTGGACAGCCA
GAGCCATCTGAGCCGCGTCCGCCTGCAAAGGACGACGACGTCGGTTCACCTCCAATTGCTCTGGAGCAGCAGCAGCAACA
TGTGGAGCCGATGCCAGAGGAGGAGCCAAGGCCAGAGAAGAACCCGAACCCAGAGGAGGAGCAGCAGGAACAGAAGCATC
AGGAGCAGAAGCATCAGGAGCAGAAAGCATCAAGCAGGGAGCAGCTGTGGCAAGAGGAGCAACAACGGCCAAGAATCATC
CCAGTGTCAGACGGGCAAAACCATCAGCATGCTTCCAATGGTGATGGACCTGCAGCTCCTTTCCAGACCCAGCAGCCCGG
AGTGGTCCGAAGGCCTTATCCACCCGCCGCTGCAGGCGACAGCAACGCCACTGACGAAAAGGGCCGCCGATTCTCCATGA
TCAGCAACTGGCGTCAGTCTATTCATGGCACGCCACCGCCCTCATCACACTCTGTACGGCCGCCTCCGTCATCCCACGAG
ACGACATCGGACAGGACGCCTTCTTTGCACCGGCAACCTCAGCAACATCAGCAGCACCACCATCAGCACTCTACCGTCGA
CAAGCTACGGGGCTTCCTTCCCTTCAATAAGGGCAAGCAGGACAGCGGCAGTCGGCCACAGTCGGCACAACCACACATAT
ATCACGACGCCCAAGACGCTCAGAGGTCACTTGGCTTCCAGGGACATCCAAGCAGGCCTCCACAGGGACCGCCCCTGCAG
AGACAGCCACAAAATCCGGAGCAACAGCAGCAGCTGATTTTGTCTCCAGCTACGCATATATCCAACCCACAGCTCTTCCT
CCTGAACCAAGAACAACAGCCCGGCGGCCCGGCCCCACAAAACAGTTCTTTCCCACCGGCAAGGATGCCACAAGGCTTTG
GCGATGACGGCCAGAATTATGGTCCTCGTCAAATTGCGCAGGTTCGGACAGCGCCGATCCAGCAGCAGCAACAACAGCAG
CAACAGCAAGTATTCATCTCGCCACAGCAGGCCAACCGGGCAGACACGTTCAGCGTCCCTCCTGAAGAGGAACGACATAG
TAGGCGCGGGTCAGGCCTCTTGGGTTTCTTTGGCAAAGGCAAGGGCAAGGACAAGCATCGGACATCAGCCAATATGTCGC
AGTTAGTCGCTCAACCGACACAACTAGCGCAACAGTTTGGCTTTTCTGGCCCAGACAGACCCGGAGGACAGCCAGCGCCC
AGATCTGGTTGGGAACGTGATCTAGGAGGACGTCCCCGTGCTAGCACAACAGGGCTGTCATTTCCACAGCCGCAGCAACA
GCTGTCTGTCACGACGAACATGCCGAACTCCACGATCCCTGGACTGTCGCCTTCTAGGGCACCGTCTTCTGTCAGCCCCA
ACCTCGAAATGATGACGACCGGAAAGGTGCGGAGTGCCAGTGGCCCTTGCATTCCGGCATCCAGAATTCACGGCCGTCTG
CCGTCCGCGTCCTATGGGCCACCTGTCCGCAAACCCGTGGGATCCTCGCCGCCTCCGCTGCAGCCGACACAGCCGACAAG
ACAGCTTGCAGTCGCTCTTCTGGCGCCGAATCCAGATGCTGACCTTGATCTTATTGACCGCCCGCCTTCTGCTTTGTCGG
AAGCTCCAACGGCTGCTGCTAATGGCGACATCGGTAGAGAATTGAGTCACGTGCCGTCACCATCTATCTCGACGTCTACC
CATCAGCCAGCTGCTGACGCAGTGAGCCTGACGCCGTCAATGGCGCCAACACCGCCGCCCCAGCAGCAGAAACAGCAGTT
CCACCGGTCGAAGCTGTCCTCTGTAGTGGTGCAGCAGCCAGAGGACATGGGGCAGAGACTGGCTGGGCAATACCCGCAGA
ACATGACCATACATCCCCAGCCTGGCCTAGGCGTCCCGACATCCCAGCCACAGGTGACAAAGCATGACAAGGAGAGAGAT
CGGTCCAAGAAGTTCTTTGGCCGCTTCCGCCGTCCCAAGAGCGGCACCATTGATCCTCGGGGCCCGCCACCGGGCGGGCC
TGAGTACCCTAGACAGCCTTCGCGCCAGCCGGTGATCAGCGCGCCTATGGGCGGTACGTTCCGTGGCTCTGGCACTCCTG
TCGGGACTGTTGGACCGTTCGTTCCTCCGCTATCAAACCTGGGCCTACCAACGTCAGCGTCCGAGCCGGTGCTCACACGT
GAGCAAGCACTGCAGAAACAGATATCCCAACAAGAAGTACGGCAACAGCAGCCGCCTCGGCCGATTGCGCCATTTGGGGC
GGCGTATCGCAACCATGTGCAAACCGGCGAAGCATCTGTACCGACCCGGAAGCAAATGCAGAACACGCACGGCGAGCCGC
AGTACGGAAATGTTGCTATCCCTATGGGATATGCTACCGTGTACAGCGAGGACATGATGGCGCGATCGCACCAGTTGCAG
CAGCAGCAGCAACAGCGGTTCGTGGCCTACCAGCCGCAATTGCAGATGCAACCACAACAGCACCTCCCAGCGGGTGTCTT
CCATGGTCAGGCCACCGGGTTAAAGGCTACAGGGCCTTACACGCAGCAGCTGCAAGGCCAACCGGCCATCGGTTTTTCCA
ACACAGCTCCCGACGGAGTCGTCCGACAGAACCAGGCCGTGCCACATCCGCTACAGCAGCACCCAGTTCGGTACGACTCC
CCTGCTGCTATCTACGCAGAAGTCGCAACTGCACCGTATGCACCAACGCCTCCTCTTCCACAGCAGCAGCAGCAGCAGCA
GCAGCAGCAACCAGAGGAACAGACTACGTCGACGCCGAACACAGTTTCGCCCCCAGCGGTGACTAGCCAACAGGATCCAG
TCGACAGCTCGTTTCTGCCCACGCCACCTCTACAGGCCCATCCGCAGGCCGACCAGCAGCAGGAGCTACAAATTCCACAG
GCTCCATCCCAGACAGCAATACAGCAGAAGCACATACAGGACGGCCGGGGACTGATGGCTGGAGCCTCGGACTCGGCGAT
CTCGTCGCCGCTTCATGCCACGCCTGACTCAGCGCCAGTGCAGCCCAACGGCAACACCGCCCTTTCCATGGGCGAAAGTC
CCATTGATGCCACGGACGCTTCTCTCACAGACATTACGATTGGCAACCCCATGGCGCCGGCACCGCTGCGCATTCAGAGT
CCCGTGCAGACAACAGTTGTCGGGAGCCCAACTACCACAGAGGAGGATCTCAACGGCACGTCTGTCCGAGAGGCGCCGAC
CGCTGCAGCCTCTTCGGCAGACAGTCCGCCGCCTGCGAATCCAGTCTCACCATCTGCTTTGTCGACGCCTTCACCTACGG
CTGTCTCTGTCAACGGCAGCAGCGATGCCGAGTCGGCAAAGGTGGGACGGCAGAAGACTATCCGACAGACGTCGGCCCAG
CAGGTGGAGGAGTACAAGAGGCGACAGATGCTCAAGGACCTGGAGGAGAAGATTCCGGTGTTTGTGCCCGACATGGACGA
GCAGCTGGAGCAGCAGCGTCGCAAAGAGCGCGAACAGCCCCATATGTCGGCGACCAGCTATCCGGGACAGGAGTGGAATC
CGTACGCAGAGTTTACGTTTGTGGAGGACGATTTGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62