GenePrediction:GLEAN_5397 Details

Name: GLEAN_5397
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:952723..951246 (- strand)
Length: 1478
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:952723..952399 (- strand)
Length: 325
Type: CDS
Source: GLEAN
Position: GCSC_132:952323..952246 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_132:952164..951569 (- strand)
Length: 596
Type: CDS
Source: GLEAN
Position: GCSC_132:951501..951411 (- strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_132:951358..951328 (- strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_132:951270..951246 (- strand)
Length: 25
>GLEAN_5397 class=GenePrediction position=GCSC_132:952723..951246 (- strand)
ATGGCAGTGTCCCGGATCCAGGACCGCACGGTCGAGTTCCGCACGGTGGTGCAGCAGGCACAGCGACGTCATGTGCAGTC
GTCCAAGGGAGCGGCGACAGCGCAGAAGAAGCGAGCGATGATGTTTGCTGGCGGAGGCGCATCGGTCTCGCAACAACAAC
AGCAGCCGCTGCTGGCGCCAGGCGCGTACAACGACGGGACGCTGGCGGACGAGCAGAGCGGTGCAGCGGCAGGCCACGTG
AGACGGTCAGAATTTGCGCGGCGAGCAGCAGAGATTGGGCGAGGGATCTCGGCGACGATGGCAAAGCTGGAACGGCTGGC
AATGTGTGAGTCAAGGAGGCGATGCAGCACGGCGAAGATATGGCTTACGGACGACGTGTGCTAACGAGTGTGCGGGACAG
TGGCAAAACGGAAGAGCATGTTTGACGACAAGGCGACGGAGGTGAACGAGCTGACGTTTGTGGTGAAGCAAAACCTGGGT
ATGTGCTGTGTTCTGTGGTCGGTGTACGTGTACGTGTACGTGTACGTGTCAGGAGGCCGTGGCTGACTTTGGGGTGCAGC
ATCGATCAACCAGCAGATCTCGGGGCTGCAGGCACTTTCACGACAGCAACAGGGCGGCAAGTCGGAAGAGGGCGAGCATC
GCAAGAACGTGGTGTACCTGCTGCAGGACCGGCTGACGGGCGTGTCGGCCAGCTTCAAGGAGGTGCTGGAAGTGCGGACG
AAGAACCTGCAGTCGACGCGGGCACGCACAGACAACTTCATCTCACAGGTGGCGCCGCCAGTGCAGCAGCATGGGGCTGG
TGGCGGCAGCCTGCACCAGCAGTCAGCCTCGCCGCTATATGCAGCTGCGACGACGGGCAGCAGCAGCGGCAGCGGCCGAA
ACACACCGGCACTGCGCGGCGGGCCTGCAGCGGCGTCGGGGCTTCTGCTCGATGGCGGCAGCGGCGGTGGCGATCTGCTC
TCGCTCAACCCGGTCGTCAGCGACCAGCAGCTGATGATGATGGAGGAGGCACAGCCGTCAAACACGTACATTCAGCAGCG
CGGCGATGCGATCGAGGCGATCGAGTCGACCATTGCAGAGCTGGGGTCCATCTTTGGGCAGCTGGCTTCGATGGTGTCGG
AGCAGTCGGAGATGATTGAGCGGATCGATGCGAATGTGAGTCAGAGAGTGCGATGGAGACGGCAGACGGCAGACGGTAGA
GACATGGCTGACTCTTTCCAAGACCGAATCTGTGGTGGACAACGTGCAAGGCGCTCAGAAGGAGCTGCTCAAGTATTGGG
GCCGTGTCTCGGGCAACCGGTGGCTGATTGCCAGTAAGTACTTGTCTTGCCGCTCTTTACCAACTCGACGTGCTAACATG
TACAGAAATGTTTGGCGTGTTAATGATCTTCTTCTTGTGAGTGGCCCTGTCTGGACGTCCTTCATTTTTCGCTCCAGCTA
ACATATATCACAGGCTCTGGGTGTTGATCGCCGGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62