GenePrediction:GLEAN_5398 Details

Name: GLEAN_5398
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:950792..949709 (- strand)
Length: 1084
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:950792..950735 (- strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_132:950666..950236 (- strand)
Length: 431
Type: CDS
Source: GLEAN
Position: GCSC_132:950152..949709 (- strand)
Length: 444
>GLEAN_5398 class=GenePrediction position=GCSC_132:950792..949709 (- strand)
ATGACGGACAAGACGTTTACGCTCAACAACGGACTGCCCATCCCGGCGCTGGGTCTCGGTATGCCGTGTCTTGCCGGCCG
CACTGTCGAGCCTCTATGATCTGTCGGCTTCTAATCCGTCTTCCAGGCACATGGCAGTCTGCTCCGGGCGAAGTAGCAGC
TGCCGTGGAGCACGCCCTCACGGCCGGCTACCGGCTCATCGACGGCGCGTACTGCTACGGCAACGAGGACGAGGTCGGCC
AGGGCATCCGGGCAGCCATCGCCAAGGGCGTCGTCACGCGTGCCGACATCTTTGTCGTCTCCAAGGTCTGGGCCTCGTAC
AACACGCGCGTCGAGCTGGGGCTGGACAAGAGTCTCCGGCTGCTTGGCCTCGACTACGTCGATCTCTATCTGGTGCACTG
GCCGCTGCTGCTGAACCCCGGCGGCAACGATGAGTGCTTCCCGAAGCTGCCCAACGGCGAGCGCGACATCATCCGCAGCC
ACAACCACGTCGACACCTGGAGGCAGATGGAGGCCGTCCTGAAAACGGGCAAGACCCGGTCTGTCGGTGTGAGCAATGTA
TGTTTTGTTTTTCGCTTTCGTCTTTCTCTTTCTCTTTCGTCTTTCGTCTTTCCTCTCTTACATATCCCCAACCACCACAG
TACAGCAAACGCTATCTCGAACAGCTGCTGCCACACGCCACCGTCGTCCCGGCCGTCAACCAGATCGAGAACCACCCGGC
ACTGCCACAGCAGGAGATTGTCGACCTCTGTCGCGAACGCGGCATCCACATCATGGCCTACAGCCCGTTTGGCAGCACGG
GCGGCCCGCTCTTCACGGCCGAGCCGATCGTCCAGACAGCCGCCAAACACGGCGTCGAGCCAGCCACAATCCTGCTGAGC
TACCACCTGGCTCGCGGCAGCACTGTCGTGCCCAAGTCGGTCACGCCGGCCCGCATCGACGCCAACCGCAAGATCGTCAC
GCTCGATGGCGCCGACCTGCAGCTGCTCAACGACTACTCCGACGGCCTCGACAAGGCCGGCAAGCTGCAGCGCTTCGTCT
ACCCGCCCTTTGGCATCGACTTTGGCTTCCCGGACAAGTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62