GenePrediction:GLEAN_5399 Details

Name: GLEAN_5399
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:935764..935037 (- strand)
Length: 728
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:935764..935484 (- strand)
Length: 281
Type: CDS
Source: GLEAN
Position: GCSC_132:935277..935037 (- strand)
Length: 241
>GLEAN_5399 class=GenePrediction position=GCSC_132:935764..935037 (- strand)
ATGGCTGAAGGCCTCTTCACGGACGAGCTCGTCAGCCCCGAAGTGGCGGCGGTGCTGCCGACGGGTTACCGGGTGCGGTC
GCTGCGCCGTACCGACTACGCCAGCGGGTTTCTCGACTGCTTGCGCGTCCTGACGACGGTGGGCGACGTCAGCGAGGCCG
CGTTTGTGGAGCGTTACGACTGGATGGCTGGGCAGAACGGGAGCTACTTTGTGCTCGTGATCGAGGACACGGCAGTCGGC
AAGGTGGTGGGAACAGGGGCGTTGCTGGTGGAGCGCAAGTTGTACGTGTTGTCTGCTTCTGCTTTGTGCTGTCTTTGCTC
TCTTTGCTCTCTCCGCTCTCTTCTCCTCTCTTCTCTCCGCTCTCCTCGTCTATCCTCTGCTATTCCCCACCCTCTCCGCC
CTCCCCCTACCTCTCCGCCCTCCTCTCTCCTTACCTCTCTCCTTACTCTATGCCACCTCACCGCAAGCTCTTGGCTGACT
CTCCCAGCATCCACAACCTTGGCATCGTCGGCCACATCGAGGACATTGCGGTGGCCAAGGATCAGCAGGGCAAGAAGCTG
GGCCTGCGGATCATCCAGGCGCTGGACTTCATCGCCGAAAAGGTCGGCTGCTACAAGAGCATCCTGGACTGCAGCGAGGC
CAACGAGGGCTTCTACGTCAAGTGCGGCTTCCGGCGCGCCGGCTTGGAAATGGCCCACTACTACGAGGGCGCCAAGAAGA
GTACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62