GenePrediction:GLEAN_539 Details

Name: GLEAN_539
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:494976..496405 (+ strand)
Length: 1430
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:494976..495080 (+ strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_97:495151..495234 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_97:495290..496405 (+ strand)
Length: 1116
>GLEAN_539 class=GenePrediction position=GCSC_97:494976..496405 (+ strand)
ATGGCAGAACAAATCTCACAGCACTTTGAGACGCTGCAGCTGCACGCTGGCCAGACGCCGGACTCTGCGACGAATTCGCG
GGCAGTGCCAATTTACGCGACCACGGTGCGTCTGCTCTTACAGCCGGGAAGACGGAGATGGGAGATCATGCAGACGACTG
ACTGAGCGAATGCAGAGCTATGTGTTCAACGACTCGGCCCATGGGGCGCGGCTCTTCGGCCTCAAGGAGAACGGCAACAT
CTATAGCCGTCTGATGAACGTACGTACCGGGCGGCGATGATGGGAGTGGTTTGCCATTGCTGACAGGGCGCCAGCCGACG
ACGGATGTGTTTGAGAAGCGCATAGCAGCGCTGGAGGGCGGTGCTGCGGCGGTGGCAACGGCCTCGGGCCAGGCGGCACA
GTTCCTCGCGATTGCAGCGCTGGCACAGGCCGGCGACAACATCGTGTCGACGACCAACCTGTACGGCGGGACGTACAACC
AGCTCAAGGTGTCGTTCCCGCGGCTGGGGATCCAGACCAAGTTTGTGGAGGGCGACGATCCGGAGGCGCTGGCGGCGGCG
ATCGACGACAAGACCAAGGCAGTGTACCTGGAGAGCATCGGCAACCCGCGCTACAACGTGCCAGACTTTGAGAAGATTGC
GGAGCTGGCACATGCCAAGGGCGTGCCGGTGGTGGTGGACAACACGTTTGGGGCGGGCGGGTACTTTGTGCGGCCGATCG
AGCACGGGGCAGACATTGTGGTGCACTCGGCGACCAAGTGGATCGGCGGTCACGGCACGACGATTGCCGGGGTGGTGATC
GACAGCGGCAAGTTTGACTGGGGCAAGAACGCGAAGCGGTTCTCGCAGTTTGTCGAACCGTCCGAGGGCTACCACGGACT
CCGGTTCTGGGAGACGTTTGGGCCGGTGGCGTTTGCGGTGCGGGTGCGGGTAGAGCTGCTGCGCGACTTTGGTCCGGCGC
TGAATCCGTTTGGGGCGCAGCAGCTGATTCTCGGGCTGGAGACGCTGAGCCTGCGCGGCGAGCGGCACGCACAGAACGCG
CTGGCGCTGGCACAGTACCTGGAGAAGAGCCCGAGCGTGGCGTGGGTGTCGTACCCGGCGCTGCCGAGCCACCCGTCATA
CGAACTGGCGAAGAAGTACCTGAAGCGCGGTGGCGGTGGCGTGCTGAGCTTCGGCGTCAAGGCCGGGACCGGTGCTGCCG
GCAGCCGGGTGGTGGACAACCTGAAGCTGGTGTCGAACCTGGCAAACGTGGGCGACTCCAAGACGCTGGCCATACATCCG
TGGACCACGACGCATGAGCAGCTGTCGGACGAGGAGAAGATTGCGTCGGGCGTGACCGAGGACCTGATTCGCATCTCTGT
CGGGACGGAGCACATTGACGACATTATTGCCGATTTTGAGCAGGCTTTCAAGGTGGCTGAGGAGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62