GenePrediction:GLEAN_53 Details

Name: GLEAN_53
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:374339..375657 (+ strand)
Length: 1319
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:374339..374477 (+ strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_179:374561..374887 (+ strand)
Length: 327
Type: CDS
Source: GLEAN
Position: GCSC_179:374957..374969 (+ strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_179:375030..375657 (+ strand)
Length: 628
>GLEAN_53 class=GenePrediction position=GCSC_179:374339..375657 (+ strand)
ATGAGGATCGGTTGCCTCCAGTTTGCTCCGCAGGTTGGAGACATCGACAATAACCTCAACCGAGCCGATGCGGTCCTAAA
CAAGTCACCCGATCTGGAAGACTTGGATCTCCTCGTACTTCCTGAGTTGGCTTTCACTGGTAAGCACATTATCTTCTTGG
GTTTCGAATTCGCTACTATCTATGTTCATTGCTCGCGTTTTCTGTTAACAAGTGATGACCAGGCTACAACTTCCATTCAC
TGGCGCAAATAACGCCGTTCCTTGAACCGTCGGGCTCGGGTATCAGTTCATTGTGGGCACGCACAACCGCCCTTAAACTC
AATTGCAATGTTGTGGTGGGCTACCCTGAAAAGGTCGATGTGGCGAACAAATGGCCAACGTCTCCCGAGTTCTACAACTC
CGCCATCATGGTAAACAGAGACGGAGAGACAATAGCGAATTACCGCAAGTCTTTCCTTTATGCAATTGACGAGACCTGGG
CTCTCGAAGGTCGAGACGGATTCTACGAGGACGAGATCCCCGACCTTGGTACTGTGGCCATGGGAATTTGTAAGTGATAC
CGTCCCTCTTATATAGAAGCAGACGAATGAAGAGAGCTAACATTCTGTCTTCCTGCAGGCATGGACATCAAGTAAGTACA
TGGGACAACAACGTCGCAAAAGACTGGATTGACTGCTAACCCCGATGTCAGTCCGTACAAATTCGAAGCACCCTGGCATG
CGTTCGAGTTTGCGTTTCACGTTCTCGAGATTCAGGCAAACCTAGTCATCCTGACTATGGCCTGGGTTACGCGTGAACAC
CCTCGTTCATTTACGCAGTTACCACAAGAGCCTGACTTGGAGACACTAAAATACTGGATTCAGCGCCTGGAGCCTATTAT
TCGGAGTGAAAATGAAGAAGAAATCATAATCGTCATCGCCAACCGCACAGGCGTCGAGGACGATTGTGTCTTCACTGGAA
GTAGCACTGTTCTCGGCGTGAAGAAAGGAGAGGTGAACCTGTATGGCCTTCTAGGACGTGGCGTCAAGGAAGTTTTGGTG
GTCGATACCTCGAGAAAGCCATTTGCCAAAGTTGTCAAAGATGACACTGGCGAAGAGGTTGAAGCTGGTGGCGCATATAA
GCAGCCGCCGCTGGCTCAAGCTACGGGGCAGTCAACTAAATCCATGCCGTCCACGCCGACGAGCTCAGCGTCTGGTAGCT
CGCCTTCCAAAGGCACACTGAATGGGGAGCACCGGCCAAGACGAGACCACACACCGGAAGCCATACCAGCCACTGCTAAG
CCGCACACCAAATCTCCAACATTGACCTCGCCCCGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62