GenePrediction:GLEAN_5400 Details

Name: GLEAN_5400
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:934424..932548 (- strand)
Length: 1877
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:934424..934267 (- strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_132:933980..933854 (- strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_132:933798..932788 (- strand)
Length: 1011
Type: CDS
Source: GLEAN
Position: GCSC_132:932730..932548 (- strand)
Length: 183
>GLEAN_5400 class=GenePrediction position=GCSC_132:934424..932548 (- strand)
ATGCACAAGGCTACATATATCGCCGGCCCAGCACCTCACAGGGCTAGTCCGACTCTGACTCGCCCAGGCCGATCTTCATC
GCTCGACGAGAACGCCCGATTTGTCACCTACACGCGCGGTGCCGTTGCCAAGATCCGGTTGACCTACATCCGTCTGCTGT
AAGTATCTTTTTCCCCTCTCTTGTTCCTTTTTTCTTTCTTTCTTTTTTTCTTTCTTTCTTTTTTCTTTCTTTCTTTTTAC
TCTTTCTCTTTTCCTTTTCTTTTTCCATCACCCGCTGACCAATAGCGCCCGCAACAAACTCACTTCCACCCACGAGGTGC
ACCGTCGTCGCCGCAGCCACAAGGTCCAGGCCCTATACGTGCCTGGAACGCTTGCACCCCGATTTGCCAAGCGCACAGTG
ACGCGCACGCTTCTTCTGTGACTTTGTCCCGACCGTACGGCCAGGATGCCCCCCCCCAACGGAGCCGGTGCCGCGCCGGA
GAGCTGGCTGATGGGCAAGGAGGCCTTTGAGGGCCGCATGCCACACCATAACGGCATCAAGGCGCTGTGGGAGACGAAGT
GGAGGTTTCCGGTATGTGTGACCTTGGAGCTGGCTATCTGTCCTTTCATGCTGACAAAGGCACAAGTGCTCCATAAGCGT
GTATCCGTTCCATGACGGCCAGCCAGAGGACTTTGCGCCCATCTTTGAGCACCTGATTGAGCACGACATCAACGACGGCA
CATCGGCCGCGTACACGGAGGCCTTCTTCCCCGTGGCAGAGGCGCTGACGGCACGGGCAGAGACGCTGCTGTCCGAGGCA
GACAGCGGAGGTGCAGATGCGACAGCCAAGACGAAAGAGGCGTCGGCGCTGCTGCTGCGGGCATGCTGCGTGTACCGGAT
CGCACGGTTCCCGTACATCACGTCGCGGCCGACAGTCAACGACGTGACCAAATGGCGGGCCTGGGAGGCGCAGAAGGCGG
CGTATCTGCGGGCGGCCGCGACGTGGGAGGTGCCCATTTGCGAGGTGGCAGTGCCTCACAGACATGGGCTGGCAAACGAG
GGCCACACGATCCCTGTCTACCTGCGGCTGCCCCCCGGTGCCAGCAGCTCGAGCAAGTGTCCGGTGATGGTGCTGCTGAC
CGGTCTCGACGGCTACCGACCCGACAACACCGGCCGCTGCGACGAGTTTCTGGCACGTGGCTGGGCCAGCGTCGTGCTCG
AGATTCCCGGCACTGCTGACTGTCCGGCTGACCCGGCCGACCCGGAAGCCCCTGATCGACTCTGGGACAGCCTGTTGGCT
TGGATGGCTGCCGATGTGCCGCAGCTCGACCTCGGCCGCGTTGCCTGCTGGGGCCTCAGCTCCGGTGGCTACTACGCCGT
CCGCGCCGCTCATACGCACGCCTCCCACCTCGTCGGCGTCGTCGCCCAGGGCGCCGGCGTCCATCACTTCTTCTCGGCCG
ACTGGCTCGCCCGTGCCGACGGCCACGAGTACCCCTTCCGGCTGACGCCCGCTATGGCTGCCAAGCACGGCTTCTGCACC
GGCGACGACGACACCGCCGGCATCGCTGCCTTTGCTGCCGGCGGCGCCCTCGCTCGCTTCTCGCTGCTCGCTACCGGCAT
CCTCGACCAGCCGTCGACACGGCTGCTGCTGATCAACGTATGTGTGGTTGGATGACATAATACAAAGACATCTTACAAAT
GCTGACTAATCTAGGGCACCAAAGACGGGCTCATGCCCATCGAAGACTCAATGCTACTATTTGAGCACGGCACGCCCAAG
GAAGCCCGCTTCTTCTCGGGCGCTCTGCACATGGGCTACCCGATGGCGAATGGGTCGGTGTATCCGTGGCTGGAGAGTGT
GATGAAGTCGACAAGTGGCAATATTAGCAATAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62