GenePrediction:GLEAN_5401 Details

Name: GLEAN_5401
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:917415..915896 (- strand)
Length: 1520
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:917415..917187 (- strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_132:916927..916781 (- strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_132:916167..915896 (- strand)
Length: 272
>GLEAN_5401 class=GenePrediction position=GCSC_132:917415..915896 (- strand)
ATGTTGGCTGCTGCTGTGAAGCTGCTGCTACGACCCGAGAAAATATCGCACGTTGGCGAGGCTGCCGAGGTCGAGCGGGC
GGAACGCGACGTTCACCTGGCCGAGAGTGTGGTTGATCTTCTCTGCGACGTCGCTGCGAGCAACAGCTACAGCGCATTGG
TAACCCAGACTGAAGGTCCCACCCGTGATAGGAATGGTGCCCTTAAAGGCGGTCATGAAAACGATGAGGGTATCGGCAGC
AATCAATAAGACTATGGGCTCCCGAGGATAACACAAATGATAGCCATGGCACCCAGGACCAGACTTTTCTGTGTCACAGG
CCTAGACTCCATTCTTCCAAAAAGTGCAACGGTACCAACAGTTTTGTGGATGATGACTGGCCACCCACTTCGAAAGAGCG
ACCCGTTCAGGTTAGAGGAGAACGGAAAGCTGTTTCCATTGCGGGACAAAGCGTTGTAAAGATTTGATATTCACTCTTCG
TTCGACAGTATCTCCAGCGCTATTCTGCGACACGTCCTCTAGTGAGATTACCGTGATAGAAGAAACGCCTATCAAATCAC
GCAGCCTGGAAGTAGCGCCCCCAACCAACCTGTTGTACTACTCAGGCACCCATAAGGCCATTTTCTGCAAGATACGTTAG
TGCTGTACAGCCAGTTGCCTTAGCTCGCCATCTGCAAGACATCCAAATGTCTACCGGAGCAAGAGACGGCATATTTTGCA
TATGCTAGCGGACTGACAAGTTCCCCGTGCCATCTGCCGGTCGAGCAGGGACTGCAGTACAAAGCGCCTCTGCATATAGA
TCAAGAAATCCCCCCCAAAAAGGAGTGACGTCTAACAGACTTGTTACCTGGACGACGTCGAGTTAAAAGCTAAGTCTATA
ATAGAAAGCCAAGTCCGCATCTGATCGAAGGAATAACCCGGATGGATAACTACTTTAAAAAATGAGCACTGTCTGTATAT
TGTTATATAAGATGGTTCCAAGGCGTTTAATACGAGCTCTACGTTCCGGGTTGACGGCATCGTGACTCCATCACCGATGG
TGGTTTAGGTACGTCTTCGTGATAAATTTTTGGATTGCTCCTCTTCGTTCTACACCCCTATGCAGTAATCGGTCTAGTCA
TGGCCCGCGCTCTTGCCAAGAACAAAGCCCGGAAGATTTGTATTCATGGACGCCGCCTCGTCCTGCTTACTGATGCGGCC
CGAGAGCATGAAACCCTTGTCCCACCGTGCGACGTGACGTCCAAAAAGACGCTCAGGATGTCGTGGACCACGTCATTGTC
GAGATGGGCCACGTCAACCTGGCCATTGCCAAAGCCGGAACTCCTGGTCCGGCGGCGCGCTTCAACCCGAGCCGGTTTTT
GCAAAAGACGCGGAAGGCCATGCTTACGGACTTCTCCATGGAGGAGATAAACGAGACACTGAGCCTTATCGTCACGGCTG
CTTTCTTCACCTTGACAGCCATCTTCGAGCCACTCGATGCGGGAAACAAGAATGTGATAAAACTTGCAGACAGCTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62