GenePrediction:GLEAN_5402 Details

Name: GLEAN_5402
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:915165..914247 (- strand)
Length: 919
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:915165..914942 (- strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_132:914874..914455 (- strand)
Length: 420
Type: CDS
Source: GLEAN
Position: GCSC_132:914373..914247 (- strand)
Length: 127
>GLEAN_5402 class=GenePrediction position=GCSC_132:915165..914247 (- strand)
ATGTCTGAAACGACACTTCCCGAGCGGCCAGAAGCGCTCGTCAACAACGCAGCCGCCAAGCAGTACTGGGAGGAGGTCAG
CGCCGACAACAACGGCATGCTCGGTGGCTTTCCGTTTGTGTCGCGTGCAGACCTCCGGGTGTCGCGCAGCTTCTTGGCCA
AGCTGGGCATCGGCAGCAAGTCGGGCATGCGGCGTGTGCGACTGGCCCTGGAGGGTGGTGCAGGGTGGGTTTGTTTTGAG
TCTATTTTTGGCAGCTCTGTCTCTCTGCCTTTCTGCTAACCCCAACGACAGCATCGGCCGTGTGACCGAGGGCCTGTTGT
TGGATATGGCCGAGGAGGTGGACATTATTGAGCCCGTCGCCAAGTTTACGGCGCAGCTGAAGGAGCGGTTGGGTGTGCGG
TGGGTCTTCAACGTCGGTCTCGAGGACTGGGATCCAACCAAGACCGGCGACACTGCCAGCGAAAGCAGCAACAGCAGCAG
CAGCGGAAAAGAAGGGACAGAGGACGACAAGGATGGAAACAAGCACCTTCCGACGTACGGACTCATCTGGATACAGTGGT
GCACGAGCTACCTGAACGACAAGCAGCTGGTGGAATTCCTGCAGCGATGCGGGTCCGTTCTAGAGCCCACGACAGGCGTG
CTCGTCATCAAGGAAAACATCATGTCGACTGGCTTTGACGACTTTGATGTGCTGGACAGCGGCGTGACAAGGTAAGTGCC
CCTAGAACATTTTGGGCATTGCTCGCTCGTTGCTCTCACTTCCCCCCTGCTACCGGCTAACCGTCCGTGCAGAGCGGACA
AGTCCTTCCAGAGCCTCTTTTCCGAGGCCGGGCTACGAGTCGTGCGTTCCGAAGTACAAAACTTTCCAGAAGAAGCAGGA
CTGCTTCCAGTCAAGCTCTATGCACTCAAGCCAAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62