GenePrediction:GLEAN_5403 Details

Name: GLEAN_5403
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:904085..902651 (- strand)
Length: 1435
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:904085..904011 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_132:903960..903833 (- strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_132:903778..903737 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_132:903688..903622 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_132:903565..903525 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_132:903457..903368 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_132:903304..902956 (- strand)
Length: 349
Type: CDS
Source: GLEAN
Position: GCSC_132:902893..902651 (- strand)
Length: 243
>GLEAN_5403 class=GenePrediction position=GCSC_132:904085..902651 (- strand)
ATGCCGAGTCCATTAGTACCAGGAGAAGGTGAGCTTCAACTGCCGCAGCACTGGACAGAGCAGCCACGGCCGGAAGTAGG
TTCTGCTGTCCCTCATAGCCTGACTTGCTCCTGACCTTGGTGTAGGGTGACGCCGACTCGGCAAATGGCGACGATGTGTC
CAGCTCGACAGCATCCATCTCGTCGAGCATTTTGCATTATCGTTCTATCAATGGACGCACGTATCACAGCGATCGTGGAA
ATAACCACTATTGGTGAGTCACCCAGAGTGTCAGCAAGGGTAAGAACAGAACACTGAACGTGCACAGGGGCCCCAACGAC
GATCGCCAGAACGAGGCGCTAGACATCATGTAAGCCCGTGGAACGTCTTCCTTAGACGGCTGTACTCTAACGACCAGGCA
CCACGCATTTTTGCTCCTTCATGACGACAAACTCCATCTTGCGCCCCTGCTGGACAACATACAGGTGAGATCGGTTGGTT
TTAAATGCACTAGTGGCTGGAAAGCTGACAATTGGTGCAGAAAGTCATCGACATCGGAACTGGCACAGGCATATGGGCAA
TGTAAGAAGCAGCATGGCCATTACTTCACTGAAACAGACAAGAAAATGAAGGCTAACTGTCCGCGTAGAGACTTTGGCGA
CACTTATCCCAATGCAGAGGTCATTGGCACTGACTTGTCGCCTATCCAGCCTGGCTGGGTCCCGCCCAACGTACGCTTGT
AAGGAAGGCCTCAGCATTTAGCTTCTCATCTACACAGTAAAGGCTAACCAATCTACTTCAGTCAAATTGATGACTTTAGA
CAAACATGGTTGTTCGAAGAGAATTCAATCGACTATGTGCATATGCGGTGGCTAATTGGCTGCGTTGAAGACTGGACGGC
GCTGTTCCGAGAGATCTTCAGGGTCCTGAAACCCGGCGGCTGGATCGAAACTTCCGAGGCAAACGGCTTCTACGAGTCGG
ACGACGGAACGCTGTCCGAGAAGTCCGCCATGGCCCAGTGGGGCTATCTTTTCCGCGAAGGAGCTAAGAAAATGGGTTCC
AAGGCGTCTTATAGTGTTGTACGTGACAAGATTCAGAGAAAATCACTCGAGGAGGCCGGCTTCGTCAACATACAAGAGAA
GATGTTCAAGGTGTGTCCCATTCCATGTCTCTCTAATTTACTCTGTTGATTAACGGTCTATTTTCTCCACAGATGCCGTG
TGGAGAGTGGCCAGAAGATCCGAAGCAGGCTGAGATTGGTACATTTGTGAAAGCTGGACTTGAGAATGACATTGAAGGTA
TGATAAGCTACTCGGCATCCAAGCTCGGCTGGACCCCGTCAGAGGTGATTGTGTATGCTGCTCATGTCCACAAAGAACTA
CGGGACAAAAGCTTGCATAGCTTCTGCAGGATTAACGTGGCCTGGGCTCAGAAGCCAATCGTTGCCGACGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62