GenePrediction:GLEAN_5404 Details

Name: GLEAN_5404
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:901404..900751 (- strand)
Length: 654
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:901404..901068 (- strand)
Length: 337
Type: CDS
Source: GLEAN
Position: GCSC_132:900938..900751 (- strand)
Length: 188
>GLEAN_5404 class=GenePrediction position=GCSC_132:901404..900751 (- strand)
ATGGAATCACAGGCGAACACATTACCAGAGATATGGGTCGTGTCCTCCGCAATCGAAACAGCCCCAGGCCAGGACTACAT
CGTTTTGCCGGAGCAGCGGTGGCTCGATGGTGATTCCGTGGAACCCAGGGTTGCAAAACAGTGTGTTGCAATGGCTATAA
TTCACTCTTCGACTGAAGAGTCGGCTGCTCGAAAAGACAAGAGCTCATCCATTGGAAAAGGACTGCTTCAGGATTGGTAC
GATGATGGCAACGACCAAGACTACCGGAACGGGCAGCGTGTCTCTGTGCCTGCCGGGGTCTCCATCGAATACCAGATAAC
AGGCAAGGTTGAGTTTGGTGGGTTGCAGCTACAAATAATACCCGCCTTTGATACCAAGAACATGTCTGTTTCGTCGATCA
AAACTCGCTCAAACGTATGGCCGCCCTATCTTTCTAATACGAGACCTTAACTGGCTGGCGTCGCAGAAGTGGCGGGCGAG
AGCTTGCAGAAAAATAAGGAGAAGCAAATATTCGATTTGGAGCAGCCGAGTGCATTCGCGCCACGCATGGGATTGCTGCC
AAACGGTGGTTGGGGCTATTTAGACTCCGGCGCCGCCGATGCCGACACCATGAATAAAGACCCCGAGCTTGGGACGGCGG
GCTCTGCCGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62