GenePrediction:GLEAN_5405 Details

Name: GLEAN_5405
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:897940..896413 (- strand)
Length: 1528
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:897940..897924 (- strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_132:897712..897238 (- strand)
Length: 475
Type: CDS
Source: GLEAN
Position: GCSC_132:897189..896701 (- strand)
Length: 489
Type: CDS
Source: GLEAN
Position: GCSC_132:896637..896413 (- strand)
Length: 225
>GLEAN_5405 class=GenePrediction position=GCSC_132:897940..896413 (- strand)
ATGATGCACAATGATCTGTACGTATCTTATGTCTCGTTGATATGATAGAGCTGATTTTTTTGTGACAGCTGAGTCAAGAT
CGTTTTGTTCTTTCTCCCTCCCTCCCCTTTTTTCTTCTCCCCCCCTTCCTCCTTCTCTCTCTAATATATGCAGAGATCAG
CTTTTCTTCGATCGAGTGTATCCATTTGCACCCGTTGTGCAGATACATCGTTACCGTTCTTGGTCCAGAGAACCTGGCAA
GACCAAGAAGAAGGATTGCCTGCAGCATGCCATGTGGACCTTGGCCACATCGCGCTCGAGCCAATTCCAAGTTTACGAGT
GCAAGCTGTACGCCAAGACAAGACAACTGTTTCAGGCATTTGAACCCGAAGAAACGTGCCATCACTTATGCTCGGAGCTG
GCGCAAGCATGGACCCTGCTGGCCATTTACGAGCTTACGTGTCAAGACTTCCATAGGGGTCTGATGTCGGCAGGAAGGGC
CTTTCGGTTGATCCAGATGATGAGGCTCTATGAGTTGGACGCGCCGCAAACAACGCCCAACATGCAGCTCGAGCAGTGTC
CAGGGATTGTCCATCTGCAGGACCCGGTGCAGGAAGATTGGATCGATCTGGAAAGCAAGAGACGAACGTTTTGGCTTGCC
TATACCATTGATCGGTTCACAAGCATGGTCGATGGACTGCACATGTTCTTCGACGAGCATCTGGTGTGTGCATTGTTCCA
GCATTTACTTGCCTTGCTTACAATTCATCAGATCCGCACTCGCCTGCCGGCTTCCGAGGTCAATTTCGTCAACGGTCTTT
CCACGAATATGCGTTTTCTTGCAGACGTCATTTCCGGTGATGACATTCGGTGTACGGACGGCGATCTCTCGCCATTTGCG
GAGAGTGCCATTGCGGCTGCCATCTGTGGACGGGTGTTGGAACACAAACAGAAACCTCCATCTAAGCTGCAGGACTTTTG
TAGTCGACATCGTTCACTTTACGCATTGCTAGGACAACGCATAGATTTGCTGCAAATCTATGCTTCACTGGAGTACCCAG
ATCCCCTCATTGCCTTTGCTACTCTGGGGGCACATGTGTCTGTGCTGATGCTCTACGAGCTTGCAGAATCCAGACCCTTG
GGCAGTGAGGCACAGGGAATGCGGCTGACACAGGCGCTCTCTGCCGAGCACAAGCAGCAGTCACTGGATGCGGTGGACGA
TGCGGCTCTAGTCGTCACAGTGCTTGGTCAGCATTTCCAGGTACATAACTGGGCAACCGATGAAGCAACATGGATCGCCA
TCGCTACTAACATTTTGCCGCAGGTGCATCCCTTGACCCCCATCTTGCTGCTTTTGGGTGGTCGATTCTCCCAGTCCCAT
CCCGGGTTCAATAATGCCTATGTGAAACTCATACCAGGTATCATGACGACACTGCAGGCCTTTTACGGGTTGAACAAGGT
TGCTGAAGATTTTATCGAGCTCTTGAAGTCCGGGAACGAAAAGTACAACTACTTTTCTCAGACTGAAGTGCCAATGTCGA
TGCAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62