GenePrediction:GLEAN_5406 Details

Name: GLEAN_5406
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:887952..885194 (- strand)
Length: 2759
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:887952..887878 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_132:887797..887320 (- strand)
Length: 478
Type: CDS
Source: GLEAN
Position: GCSC_132:887204..887132 (- strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_132:886817..885194 (- strand)
Length: 1624
>GLEAN_5406 class=GenePrediction position=GCSC_132:887952..885194 (- strand)
ATGTCCGCAAACGTTCCTCCGGATCCGTTTCGCAGAAACATGGAAGCGACGCAGGATTTGAATCAGCCCCACAGCGTAAA
ATGCAGAAATACATAATGCCTGCCGCGAGCAGCCCCTAGAACTTTATCGTAAGACCACACTCTAAACCCACAGAGAACAC
CACGGTACAAAACGGAACTCCCCTTCCGGCCAAGCTCGCTGGCCCGCCTCTGAGCGACCGTGAAGCCATTGCAGACGCAT
GCTACCGCGCGTTTCTGTCCATCGACCAGTCTGATGAGAAGCTTCTCAAGTCCAGCGTGACGCCCGATGTTTACACATAC
ATCGCGTTCAAAGCTTGCCATGGCTACGAAGAGCTCAGGGACAACGTTTGGACAAAGGTCCACTCTCTCATCGACACGGT
CCACTACCTCACCAACATGCGCGTCAGCGTTGACTCTGAAACCACAAGTCGTGCGACCTTCAATGCCATGGCTGTTCATT
GCGTGCTAGGCAAGGGCTACGAGACTGACTCTCCCAAGTTCAACAGTGGCGCTTTCTACAACTGCGATGCCGTCAAAGTG
GACGATGTGTGGAAGTTGAAGACGATGAAGTCCACCCATGTTTGGGCGACTGGTGATCATAACGGGGTCATGGGTGCGCT
TCATTGAGCAAGGAATGTTAGAAGTGGTGTCTGTTAGGCCACGAAGCCAGACGAAAGAGATTGCTTTTTTGTCTACTTGA
ACCATGTTGACACAAAGCTGGCGCACAGGTGACCCCGTGCTCGCTACTACGTCGTATACCCGGCGCGACTTAACCGCGGC
TGCGGACTTGGCTGGAGAGAAGTGGGTCAACCGCCTTAGTAAAGTGGACCGATCGGGCCTCTCTATCTAGTACTTTATTT
TTAGTACAGTTCGCTCACGTCCGATGGCCATCGGCCGCTAGTTTGTCTAAAATTCACACAATTATCCCTCTCGATCTCTG
CTAGACCCGCTCTTGACACTCTGCAAAACTCCTCTGCCGCACCAAGGGGAATGTCGATGCCAACCGCCGGGCGCAAGCGG
GCGCGGAAAGCATGCATGCCTTGCCATCAGCGCAAACGGAAATGCGATGGTGAACTCCCTTGTGGAACATGTACCACCTA
TGAGTACACCTGCAGTTACGCCGTAGGCACTATTGACGACGACATCACCAGCAACACTGCGTACCCACCAGTCAAACGTG
CCAAGGATGATGGTGCTAGTAACACTGCTTCCGCGTCACGGAGTCCGGGTAAACCGTCTCCAGCAGAGCCAAGTCCGAGC
GATACGGGAGGCTCCTCGTCTTCGGCACGAAGTGTACACGCAGCCGCGTCTGCGCCAGCTGGCATCTTTGACGAGCACAA
GTCCAAGTATGCCGGGAGATCTGCTGTCATGGCATTCCCCCATGTTCTGAGCGGCGTCCTTGGCTGTGACAGCCCTTCGA
AACTGCACTCTCTCGCTTACAACTTTGGCACGCGGTCCTCAGCTGCCTCAGACGCACGCCATGTCCCTCTAGGCACGCTC
ATCTCGGAGGAGGACCTGAAGGTGTACTCTGACGTGCACTTCTCAACCCTGGCGCCGATCTTCGACTGTCTCGACCCAGA
AATCTTCGCCCAGCGATGTCGAGACTATTATCTTGGCTTCGGCACCGACATAACCGCGTTTGGCGCCGTGGCTGCCGGTG
TGGCTGCTCTGGGTTCGTTCCTGTCCCCCATTGGGCACCCGCGGGAGGCCGAGCTGGTGCAGTATGCCAAGGCCATCCTC
GACGACACTGCTTCCATGCGCGTGCTGGGCATCGACCACATCATTGCCTGGGCCATGCACGTGTCCTATCTACGCGCCAC
AAGCCTGCCCGAAAACGTCTGGATTGCCTCCTGCACAATGATGCATCTCTGCGAAGCCGTTGGGCTGCACGAAGAAGAGA
ACATCAAGAAGACGGCGGCTGTCGCCGGTGCGGCTCTCCTTGGCCACGATGCCGACCGGTTGCGGCGCATCTTTTGGGTC
TCATGGGCCGCACATAACTTTCTCGCCTACGAGTACGACCGCTCTGCCGTCGCGTTTCGTGCTGTCACCTGCAATTCCGT
CCTTCTCGTGAGCGGGTCTGTGGCCGACCAGTTTGTGCAGATCGCCCAGATCATCCCGGCGCCCAACTCGCCCTTCCACC
TCAAATGCGAGACGTCTTCGCTGCGCGAAGAGCTGTTTGAGCGTCTCCGGGCACTGGACAGGCTTCGCCTTACGCACCCA
TTCTTGGTCGTCACCAGGGCGGACCTCGCCTTCTGCTTCTATCGCCGCATCTACCAGCTCAAGCAGGGCATTTCCGACGA
CATCCTTCAGCTCGTGATAGATGCTGGAAAGGCGGCAATTGAGGCAGCGCAGCAGCTGGTGAACCAGGGCCGTCTCTTCT
GGAACGTCATCGGTAGTGCCTTCCAGTACATCTGTGTCCTGCTCGCCATGGACACGCCGATCGCTTCGACGCATATCGCT
GCTGCCTTTCAAGGCCTGGAGAACCTCACCATGGCTGTCGACACGGAATTGACACGCGAAGCATTGTCGATGGCACGGCG
GCTCCTCCGTCTCAACGCGGACAAAAAACGAAAGGAACTTTCCGAACTTGAGGCTGTCGAAGACAGTCTGCAACCATTGG
AAGTACAGTCAGACGCCGAGGCGGCGATGGTGGGCAATACAGCGCCACACATCACCTGGGACATGCTAGCCTGGGAGCAG
TTTCTCGCTGAACCATATCGATCAATGTTTGGATTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62