GenePrediction:GLEAN_5408 Details

Name: GLEAN_5408
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:877758..869272 (- strand)
Length: 8487
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:877758..875513 (- strand)
Length: 2246
Type: CDS
Source: GLEAN
Position: GCSC_132:875470..875080 (- strand)
Length: 391
Type: CDS
Source: GLEAN
Position: GCSC_132:875014..870897 (- strand)
Length: 4118
Type: CDS
Source: GLEAN
Position: GCSC_132:870709..870622 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_132:870567..870352 (- strand)
Length: 216
Type: CDS
Source: GLEAN
Position: GCSC_132:870298..869381 (- strand)
Length: 918
Type: CDS
Source: GLEAN
Position: GCSC_132:869289..869272 (- strand)
Length: 18
>GLEAN_5408 class=GenePrediction position=GCSC_132:877758..869272 (- strand)
ATGACGGTATCTCTACGCACCTCACTCTCCAATGTCCAGGACGCGACAAGCTTTTTGTTTGGGGGTCACATTGGGCCACA
AAGCAAAAAGTCACTGGACAAACATGTACGACAGATCGTAGACGGTCCTAACAGAGAATGGATTCTCGAGGCCTTGGCAG
ACCTGCCACGGTATTGGGATGCCATGGCCGAGAAGATGCCTGAAGTGGCTGGCACAATGCAGGGTGCCACTCTGCTTGCT
GAGATTGACTCCTGGTTTCGACATGGTCCTGACTCTGTTAGCTCGCTGGACCCCGACAAAGAAATCCCCGACCTTTGGAT
CGGCATTCTCATGGTTGCCATCCAGCTGGACCAGTACTGGCGCTACCTGGAATTTCGATTCAGCGGTGCGACCGGTCTCG
ACGGGAAGGATCTGCAAGCAGAGCTGGTGAAGCAGCAGCGGCAGCAGGAAGAGGAGTCTCGGCTGGAAGGAGCCAACAAG
GCTGAGACTGCGGGATTCTGCGCCGACATGATCGCGGCAGTGGCAGTCGCCAGCTCGCATGATCGTGCAGAGTTCCAGAA
GTACGGTGCCACGGCTCTGCGGATCGGTGCCTTGATGGCCGCTCTGGTAGGGGCTACAGAAGCATGGACGAAGGAGTCCG
GGAAGGGGGGATCTGTGTCGCTGGCGACGGCGTGGCGAACGCGCAGACAGGGCGAAGACATGGCGCACATTGTGTCCAAG
GCATTCCCCGACGCCTATGTCTCGGTCCTGTTTGACGAGTGCCGGTCTACGGTGACGGCATCTGAGCGTCTAGCCCCCAA
GCTGGCGCGTCAGCTCCGGGCAGCCGGCATCACGGCCGTGCCGCTGGCGTTTCGAGGCCAGCTGCACACGCCGACGGCAG
AGCGCGAACGTTTGACGGAAACGCTGATTGAGGTGTGCCACGCACTGCCGGGTCTACAGTTTCCCGATGCCGCGCTGCTG
GCCTTGCCCACATACCTCGACCAGCCAGACGGAAAGCCGGTCTCGGGCGAGGAGGTCGACCTGGTCGGCATGGTTCTTCG
ATCGATCCTGACCCGGCAGCTGAACTGGACCAGCACCGTTTCGGGGCTGGCAGCCAAGCACGAACACGCTTCCCTCATCG
CCTTTGGCCTGGACCGGCCGCTGCCACCGACTCTTCTGCGCACGTTTGGACCGAAGCAAGTCCATTTCGAAGAAGTCGGA
GCGGAGATGCCTCACCGTGCCGAGGTGACGGTTAAACGGGGAGGGTCTGACGACAGCTTTGACGACAGCTTTGACGACGG
CTTCGACGACGTGGTGGCTGTCGTGGGCATGTCCATCCAAGTGGCAGGTGCACGTGACCTGAACGAGTTTGAGGCGATGC
TGAAGACGGGCGAGTCGCAGCATGAGATCATCACGCCGGAGCGCATGACATCCGACATGTTGTTCCGTCCCAAGACAGAC
GCTGACCGAAAATGGTATGGCAACTTCATGCACGATGCCGACGCGTTCGACCACACGTTCTTCCGGAAGAGCCCACGCGA
GTCGATGGCGATCGATCCGCAGGGCCGACTCTCGCTGGAGGCGACATACCATGCCCTCGCGCAGTCTGGCTACTTCAATG
AGCTGTCTACGGCTGATGCGGCCTGGCAGGAGCGGTACCGAAGGATTGGCGTCTATGTCGGGCTGTGCTCGTACGAATAC
GACGTCAACATCCACTGCCATCCCACCAGTGCCTTTACGGGAACCGGAGAGCTGCGCAGCTTCATCCCCGGACGGGTGTC
GCATTACTTTGGCTGGACGGGACCGTCTCGGACCTTTGACACGGCCTGCTCGTCCTCGACCACCGCTCTTCACACGGCCT
GTCGGGACGTGCTGTCCGACGAGGTGCCGGCTGCCATCTGCTGCGGCGTGAATGTGCTGACTAATCTGCAATGGACACAG
AACCTGGCCGCCGGCAGCTTCATCAGCCCGACGGGCCAGTGCAAGCCTTTTGACGCGGACGCGGACGGCTACTGTCGCGG
CGATGGTATTGCCTACGTCTTCCTCAAGAAGCTGTCGACGGCCGTGGCGGACGGCAACACGATCCTGGGCACGATTCGAG
GCACCGGCATCAACCAGAATCTCAACTCGACGCCGCTGTTTGTGCCCAACGTGCCGTCCTTGTCGACGCTCTTCCATGAC
GTGATGCGGAAAGCGCGCGTGGATCCGGGCCACGTCTCCCTGGTCGAGTGTCACGGCACAGGCACGCCCGTCGGCGATCC
TGCCGAGTAGAAAAGCATCCGCAACGCCGTTGCTGGGCCTCTTCGGAGCACTGTCCTGCCCATCGGCTCTGTCAAGGGCC
ACATCGGCCACACGGAAGGCGCGTCCGGCCTGGTGGCCCTGATCAAGGTGCTCCTGATGATGCGGCACAGCTTCATCCCG
CCACAGGCCAGCTTCCAGACGATGAACCCCTATATCCAGGCAGAGCCGTCCGACAAGATGGAAGTGGCCACGTCGCTGCG
GCACTGGCCAGGCGACAAGAAGGTGGCGCTGATCAACAACTATGGAGCCTGTGGCTCCAACTCGAGCGTGGTCGTAGCCC
ACCTGGCTTCTGAACGGTCGAAAAAGCAGACGGCCTCGTCCTCATCTTCGTCACCTCGACTGCCCTTTTGGATCACCGGC
CTCGACATCCGCATATCGCCGCCTACAGTGCTGTACTGGGTCCATATTTACACAACACACACGCCGCCACGCTCGCCGAC
GTGTCTTTCTACATGAAGTGGCAGTCGAATCCTGCTCTGCCGCAAGGACTCATCTTCAGCTGCCGTTCCCTGGACGAGCT
GCAGGAAAGGCTGGCTAGAGCAGCTACGGCGACCAAGGAGACGGCAGCGAGCGCGGACATTGCGCCAGTCCCGGCGGAGA
GACCGGTGATCCTGTGCTTTGGGGGCCAGGTTTCGACCTCTGTCGGTCTCGACCGTGCCGTCTACGAAGAGGCTGCCGTG
TTCCGGTACCACCTCGACGCGTGTGATGCGGCCATCCGGGAGAATCACGGCCTAGACAGCATCTACCCAGACATCTTCTC
GAGTGAGCCATACGGGGACGTCGTCAAGCTGCAGACGGCTCTCTTTGCGGTGCAGTATGCCTCGGCCAAGAGCTGGCTCG
ACTGTGGACTTGCCGGCAAGGTCGTGGCTGTTGTCGGCCACAACTTTGGCGAGATCACAGCTCTTTGTGTGGCCGGTGTT
CTGAGCCTCAAGGACACCGTCCGACTGGTTGTGGCCCGGGCACAGCTCGTGCAGAGTGCCTGGGGACCCGACACCGGCGC
CATGATGGCCATCGAGGCCGACGAAGCACAGGTGCACGACGTGCTCCAGAAAGCCAACACGGACTCGACCTCTGCCACAT
CGGCTGCCATTGCCTGCTACAACGGGCCGCGCAGCTTCACGATCGCCGGATCGACTGAGGCCATCGACGTATTCGCCGGA
CAGCTCGACCGAGACGGACGCGGGCTCAAGAACAAGCGTCTCAACGTGACCAATGCCTTCCACTCGGCCCTGGTGGAGGA
TCGTCTCATCAAGCGCCTCGACGAAGTCGGCAGAAAGCTGACCTTCCACCAGGCCGCCATTCCCATTGAGCGGGCCACCG
AGCATGGCAATGACAGCCAGCCGGACTGCACCTTTGCCGGCGCCCACATGCGACAGCCCGTCTTCTTCCGCCACGCTGTG
CAGCGGCTTGCCCAGAAACACCCGCAGGCCATCTTCCTCGAGGCCGGCTCCAACTCGACAATCGCTGTCATGGCTTCGCG
AGCCCTCGATCCATCGACATCGACGTCGGATGCACACCACTTCCAGTCGATCGCCATCACCAATACGAAAAAGGGCGTCG
ACCGGCTCACAGAGGCCATCGTCGAGCTCTGGAAGCAGGGCCTGCGCGTATCCTTTTGGCCGCACCACCGCATGCAGACA
AGCGAATACGGGCCGTTGCTGCTGCTGCCGCCATACCAGTTTGAAAAGTCGCGCCACTGGCTCGAACTCAAGTCGCCCAT
CGAGCAAGCCCTCCAGGTGGTCGCACAGGTCGATGGAGGAAGAAAACACGTCGGGGCCGTCGACCCCAAAACGCTTCCTC
TCTGGACCTTTCTCGGCTTCCAGGACGACAAGAAGACAAAGAAGACAAAGACAAAGCTGGCTCGGTTCCGCATCAACACG
GCCTCGGACACGTACCAGCGCCTCTTCTCGACGCATGTCATCGCCAAGACCGCACCCATTGCCCCTGCCACCCTGGAGAT
CGACCTGGCCATCGAGACGCTCTTCAGCCTACAACCAGACTGGCGCGCCAACACATTTTCGCCCGTCGTCCGTGACATGG
TCAGCCATTCGCCCATCTGTGCCGACCCGACGCGCGACTACTACATCGACCTCGAGCAGCTCGACCATGCCGGCACAGAC
TGGCACTGGACCATCCACAGCATCGGCACGTCCTCTTCCGACGACAACAAGCATGCCGACGGCCTCATCCACATGTATGC
ATCTTCCGATCCGGCACTGCTTCGTGAATTCGGCCGCTTCGAGCGTCTCGTCAGCCATGCCCAGTGTGAGGCCGTTCTGG
CCTGGGGACCGGCCGACGAAGGCGTCGAGGCCATCCAGGGCCTCCGCAATGTGTACCGGGCCTTTGACGAAGTGGTCGAC
TTTGGGCCTGTCTACCGTGGCGTGCACTACATCGTCGGCCGCGGCAACGGTGAGAGTGCCGAGAGTGCCGGGGTCGTCCA
GAGACGCCACGCCGGCAATACCTGGCTGGACGTGCCCCAAGCCGACGCGTATGGTCAAGTGGCCGGCATGTATGTCAACC
TGCTGACCGATATCCCGGCCAGCGACATGTTTGTCGCCACCGGGCTCGAGCTGGTCATGCGCTCACCCGACGTGCAGCCG
GCCACAGATGGCGACGAAAACGGCCCGGGTCTCTGGCATGTGCTGGCTCGTCACTCCCGACAGGCCGAAGGGAAGACGTA
CACAACCGACATCTTCGTCTTTGATGCCTCCACCGGTGCCCTGGCCGAGGTCATCTTGGGCCTGGTCTACGTCCGTGTTC
CCAAGGCCACGATGAGCAAGGTTCTGCAGCGGGTCACAGTCGACAAGTCGTTTGTGCGAGAAACCCGATTTTCTTCCATC
GTCGGGGCTACAGCGACAACATCGCCACCGGTCAGTCGTCCAAAGAAGACAGCAAAGCGAAACAAGACAAAGTCTGGCCC
GCGCGATATCACAGACGAGGTCTGCGCTGTCGTGGCCGACGTCTCCGGCATCGCGGTCAGCGATATGACTCTCGACAGTG
AGATGGGCGACCTCGGCATTGATTCTCTGATGGGCATGGAGTTGGCGCGCGAGATCGAAAACACCTTTCACTGCACGCTC
GACCGTGCCGAAACGGTCATGGTCACCTGTCTTGGCCAATTTGTCACCTGTGTATCAAATGCTCTGGTGAAGGCTGGAAT
GGAAGAGGGCGAAGAGAAGGACGAAGACGACGACGACGACGACGATGACAATGCCGGCAGCAACACGTCAACCGATGCAG
ACTCTGGTGGCGAATACACAACAGATACAGCTTCGGGTAGCACGACTCCGGTGGACGACTCGGGCCTGGTAAGTGGATCA
CCTACTCCTGGCTCCCTCCCAGTCCCAGTCCCACCGGCAAAAGTGATTGACAGAGGCGATGTGGCAGCCCGCGAAGCGGA
AGCACTACGACTAGTCGCAACGTTCACCGATGGCTGGGAGTCTCCCGCACTTGCTGCTGCGGAGAGTGCTACGGTCCGTT
CTGGCAGCCGTGGAGCTGTCGTGGTCGTCACCGGTGCGTCTGGAAGCCTCGGATCGCACATTGTTCAGGCTGTCGCCGAG
AGACCCGATGTTGCCACCGTTGTTTGTATCAACCGTCCTGTGAGCTCTGTGTCGGCCGAAAAGCGTCAAGAAGAGGCATT
TTCTTCCAGAGGCATCCATCTGTCGGCTGCTGCACGCCACAAGATCCGCGTCTATGGCACTGATGCCTCCAAGCGACAGC
TCGGCCTGTCCGACCACGAGTACGGCTGGCTGGCCCGACACGGCACCCACATTGTCCACAACGCTTGGCCCATGAGCGCG
ACGCGGCCCCTCAGCGCCTTCGCTCCCCAGCTCCAGACCATGCGCAACCTGCTGGACCTGGCCCGGGATATGGCCACCGG
CCTCGAGCCGCGCCGGATCGGCTTCCAGTTCATCTCCTCCATCGGCGTGACCGGCTTCGCGGCTGCGTCCCCTGTGCTGG
AACAGGCGATGCCGATGGATGCCGTGATGCCGAGCGGCTACAACGAGGGCAAGTGGGCCTGCGAACGCATGCTCACGGTC
ACGCTGCGTCGCCACCCGACACTCTTTCGGGCCATGGTGGCACGGCCAGGCCAGATTTCCGGCTCGACCGTGAGCGGCTT
CTGGAATCCGGTAGAGCATCTGGCGTTTCTCCTCAAGAGCGCGCACACTCTCGGAGCATTGCCCGATCTGCGCGGCGTTC
TGCACTGGCTGCCCGTCGACCGGTCCGCTCACGTCATGGTCGACCTGCTCAACATCGACAACCGGGCCGATGCCACAGAG
GCGTATCCGGTGTACCACGTGGACAACCCTGTCGGCCAGCCCTGGAAAGACGTGCTGGCGGTCCTGGCAGATGCTCTGGG
TGTCCCTCGCGATGGCATCGTTCCCTTTTCCACATGGATCCAGCGGGTTCGCCAATCGTCGCTGTCCACGTCGGAAAATC
CAGCCATGTTCGTACTCGGCTTCTTGGAGGGTCATTTTGAGCGCATGGCTTGCGGTGGCATTGTTTTGGACACACAACGA
TCGAGCGAGCACTCCAAAACCATGGCTACAGAGGGTCCGGTGCAGGCTGAGGTGGTGCGGTCGTATGTGTCCTCCTGGAA
GACTATGGGGTTTCTTAGATGATGTGCTTCTGCATCGCCATGTAGTGCAAATGCTGTCACTTCCCAAGTGTCGGTAATTC
CTAATGATCTGCGGCTGATCCCTCGTCAGCATACGTCGTCGTTTACGTACGAGTTTCAGCGAATCGAGACTAAACAGCGC
TTGTCAAAGTGTGGAGCACGAGAGCCGGGGCGATCGACAGTTCGTAACCAGTGCCGAGTACGCGTCAGAGACGTCCAAGC
TCAAGGTGACGCGGCTGGTAGAGAGTATTAAAGACGTGAAGATGTAGGTCTCTTCCCTGTCTGTTTCTCAGGCACACTAT
CAACAAGCCGATACGATGAAGATCCCACGCTCTGCTCTGCTGCTCGGTGCTGGTGCCGTTGGTGTCATCGCCGACGTGCA
CGAGCTGATTGTCGGCACCTTTGGAACCGACTCGCTGTACACGCTCGTCTTTGACGATGTCTCGCTGGCTCTCCATCTTA
CCGGCAACACGACAACGACCGGCGCCAGCTCCTGGATTGCTCTCAGCGTAAGTTCATCGCATTGCACTCAATCCTGCCGA
GGTACTGACAAGGCCGACAGCACGACAAGAAGCATCTCTACGGCACGTCGTTCACGTCGTCGTCGCCAGCCTTTATCAGC
TACTCGCTTGCCGGAGCCACCAACATCACGCTCGACACGACCGTCGACGCCGGCGGCAACTGCACGGGCAAGGCCATCTA
CGTCGTCGCGGCCGAGCGGGCGCCCTACAGCGTGTACGGCTCCTTTTTCGGCGGCAGCGCTGGCTGTGGAGCGGTGCTGT
CGGTTGACGAGGACGGCGCGCTCGCGGCGGCCGTGCAGAACTTCACGTACGCCAGCGGCTCCGGCGTGCACGGGCTGGCG
TTGGCGCCGTCGGGGCCGTTCCTGTACTCGGCCGACGACAGCGGCAACCAGATCTGGACGCACCACATCGACAACAGCAC
GGGCGCGGTGTCTGTCGTGGGCCACCTGAGCAGCCCGGCGACTGGATCTGATCCGCGTCACGTGACTGTCCATCCCAGTG
GCCAGTACCTGTATGTAGTGCTGGAGGGGACCAGCAAGGTGGCCGTGTATGCGCTGGACGGGACAACGGGCCTGCCGACG
GCGACGAACGTGACGTACTTGCTGCTGCCATCAGGCGAAGACGCGGCCGACTATTGGGCCGACGAGGTGGCGCTGTCGAC
CAGCAGCCGGTACCTGTGGGCGAGCAACCGGGCGCGGTCCAGCGACAGCACCGGCTACCTCTCGGCTTTCCGGCTGAGCG
CGGGAGGAACGGTGCAGTCGCAGCTCTTCCTCGTGCCGACAACGAGCAGCGGCGGGGCGGCCAACAGCGTGGCGCCCAGC
GGGTTCTCCGACCGGTTCGTCGCGCTGACAGACAGCTCGGCAGGCTTTGTGGAGATCTGGGAGATGGCGGCAAATGGGAC
GACGGCGAGTCCGGTCGCGCACATCGACCTGGCCGACGGGGGGTGTTGTGCGAACGCGGTATGGTATTCATAGGTGAAGT
GGTGGAAGTTGCACGTGATCATACAAATTTTCACTACCGATTCGTGTCACTCGTTGTACCCATACACAGTGCGTGCACTG
GCTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62