GenePrediction:GLEAN_5409 Details

Name: GLEAN_5409
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:869010..866611 (- strand)
Length: 2400
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:869010..866611 (- strand)
Length: 2400
>GLEAN_5409 class=GenePrediction position=GCSC_132:869010..866611 (- strand)
ATGTCTACACCAAGCACAACATACGTGGACCACCAGGCGCTGGCGGACAAGGCGCTGGCAGCGCGGGAGCTGGTGGGCAC
GATGACGGCAGAAGAAAAGACGGCGCTGCTGACGGGCAACGGAATGTGGAAGACGGCACGGCTGGCGCGATTGGGCGTCG
AGCCGGCGGTGATGACAGACGGCACATACGGCGTGCGATATTCGGTGCCGCAGATCGACGGCGACGAGCAGGCCGGCACA
GACCTGGATGCCTTTTTGTCGGTGGTGCAGCAGCGAGCAAGCGAGATCGACAAGGCCTGGGGCCAGCTGCGACCGGCGAC
CTGCTTTCCCAACGGCTCGGCCATGGGCTGCAGCTGGGACATCGACCTGATGGCGCATCTAGGCGTGCTGCTGGGCCGCG
AGTGCCGCACCATGGGCATCCACACGCTGCTAGGACCGGGCATCAACATCCGACGCACGCCGCTGGCCGGCCGCTCGTAC
GAGTACTACTCGGAAGACCCGCTGCTGACCGGAAAGCTGGCGGCTGCTGTCATCACCGGCATCCAGGACCAGGGCGTCGG
CACGTCGCTCAAGCACTTTGCCGGCAACAACTCGGAGATGCAACGGACCAGCATGGACAGCGTCGTGGATGCGCGGGCGC
TGCGCGAGATTTATCTGCGCGGCTTCCAGATGGCCATCCGCGACTCCGATCCCTGGACCGTCATGTCGTCCTACAACCGC
CTCAACGGCGTGCAGGCGGCCGAGGACCCCTGGCTGCTGACCCAGGTCTTGCGCCGCGACTGGGCCTACGACGGCCTCGT
CATGTCCGACTGGAACGGCATCAAGGATCGCGCCGCTTCGCTGACTGCCGGCAACGAGCTCGACATGCCCGAGAGCCCCC
GTCGCAAGGCTGATTTGCTGGCAGCCATCCGGTCGGGCGAGCTGTCGGCAGACGTCGTCGATGCCGCCTGTGTGCGCGTG
CTCGACTTTATCGCCCGCTGCCATGCCGGCTGCACCGTCCCGGTCGCTCCCACCGATCTGGCTGCCCATCACGTCGAGGC
CCGTCGCATGGCTGCTGCCTCCATGGTGCTGCTCAAAAACGATGGCGCCGTGTTGCCGGTGGCTCCGACTGTGCGTCGTG
TGCTTGTCGTCGGCCGTGACGCCGAGACCCCCGTCATCCAGGGCTCTGGCTGTGCCACCACGATGCCGACCCAGGTCGAT
GAGCCGCTGGCTGAGCTGCGGGCTCTGTTGGGCCCCGATGTCGCGATCGAGCTCGACAGCCGCAACACTGCCGACGACTC
CCTCTTTGCAAGAGCTGCTGCCGCCCATCTCGTCGTCGTCTTCGCCTCGACCGAGGGCGCCTACGATGGCGAGGGCTCCG
ACCGCTCTACGCTCGCCCTCGGACCCGGTCAGGATGCCCTCATCACTGCTCTCGCCGACCATTGCACCACCCCGATGGCT
GTCGTGGTCGCCTGTCCCGATGCCGTCGCTATGCCCTGGGCTGACCGCGTCGGCGCCGTGCTCGTCACCTTTTACAGTGG
CCAGGCCATGGGCGGTGCCGTTGCTGATGTTCTGACCGGCCGCGTCAACCCGTCCGGAAAGCTGTCGGTCACCTTCCCCC
ACCGCCTCGGCGACGTCCCCGGCTTCCTCTCCTATCCCGGCGAGCAGGGCCGTCACCTCTACTCCGAGGGCATCCATGTC
GGCTATCGCGGCTACGATTTTCGTCACTGTACTCCCCTCTTCCCCTTTGGCCATGGCCGCAGCTACACCACCTTCCGCTA
CGCCGACCTGCAGCTGTCGGCTTCGTCCATCGGTCGGTCTGGTCACGTGACCGCCTCGTTTTCCCTGCACAACACCGGAA
CCGTCGCCGGCGCCGAGGTCGCCCAGGTCTACCTCCGGGCCAAGGGCCACCTCCTTCGCCGCTCGCCGCTCGAGCTCAAG
GGCTTCGCCAAGGTCGTCCTCGCCCCCGGAGAGACCCGTCGTGTCGACGTCGCCATCGATGGCCGCGACCTCACCGTCTG
GGACCCTGTCCGCAACGACTGGGTTCTGGAGGCTGAGGATGCTGAGCTCGTCGTCGCTGCGTCATCGCGCGACCTCCGTC
TTGCTGCTCCTCTCACCCTCCGCCCCTCTGTTCTCTCCTGGGCCCGCGTCTCCTTCGACAGCCAGCCGGCCTACGTGATC
GGAAACCCTGTCGCCCGTCCCATCCTCCGTCGTGAGCTCGCCCGTGAAGCCAACATCTCCCCCCACGACGCCGACGTTGT
CCTCGACCACTGTGCCAACTCGTTTATCGGCATCTTTCCCACCCTCGAGCGCCGCCTCCGCATCACCGTGCCCAACACCC
GCGCCCTCGAGATCCTGACTATGATCAACACCGCCATGGACGAGGCCGAGCTGAAGCTGCAGGAGGGAGCTTCAGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62