GenePrediction:GLEAN_540 Details

Name: GLEAN_540
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:497100..498291 (+ strand)
Length: 1192
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:497100..497177 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_97:497638..497998 (+ strand)
Length: 361
Type: CDS
Source: GLEAN
Position: GCSC_97:498050..498291 (+ strand)
Length: 242
>GLEAN_540 class=GenePrediction position=GCSC_97:497100..498291 (+ strand)
ATGTACCTATCCGTAGCACATTGGGCGGAGCAGCGCCCCACCAGACTAGCGTTGCGTGATCTGAACCTGTGGCTTAGCGT
GTGGTTCACAGCATTGCGCAAATTCGCAGCTACATAGTACATCGTTTTGACCACGTTTGCCTAGAGAATCGACGACGACC
GGCCGCCGCGCATTTAGACGAACAAAGGACACGATGCGCGCAGCTTATTATCTGGCTTGTTTCGGGGCATGGGCGGCGAC
AGCGACAGCGACAGCGACGGCGAGCACGTCGGGATCTGGCCGGACGATGTCGTTCGTGCTGCAGGTGGGCCAGCCGCGGC
TGTCGGCGGCGAAGCAGCCGGCGACGGCGACGGTCGAGGGTGCGGCGGCAGCGGCGGCGGGGGGACAGCAGGCGATTGAG
GCGGTTCTGAGCGGGATGCCGTCGTGGACGCGGGCGACGCTGGAGGCGGGCGGCGGACGGCAGCACGAGTCGGCGCCGGT
GACGGCAGACGGCCGGTTCGTCTTCCACAACGTGACGGCCGGCTCGTATCTGGCCGAGGTGCCGTGCGCGACACACTTCT
TTCCGCCGGTCCGGGTGGACGCCGTGGACGTGGTGGACGGTGGAGCGGCCGGGAAGCCGGCCCGCCTTGTCGTCACCGCC
AGCGAGACGTATCGCGGCAACGACTGGGCCAACCGCGGCGAGGCGCTCGTCCGGGTCGACAGCGCTGCTGCTGCGGGAGC
ATCGTCGTCTTCGTCGACCATCCCCACGTTTGTCCTCCGTCCCATCTCTGCCCAGCCCAAGGCCTACTACACCGACCGCA
GCGGCTTCTCGGCCCTCAGCATCCTGCGCAACCCCATGATCCTGATCGCCCTGGTCACCATGGGCATCGTGTTTGGCATG
CCGTACCTGGTGGAGAACAGTATGTCCCCCCCTTGCTTGGATTCGGCTTCGTCTGTCTAACCCGACCTAGTGGACCCCGA
GATGCGTGCCGAGTGGGAGGAGCGCCAAAAGTCCAACCCGATGAACAGCCTGATGGGCGCTGGCGTCAGCGGCGCTCCCG
GTGGCGGCGCTCCCGGAACCCCCAGCTTCGACATGGCGGCCTACCTGGCCGGGAGCACCAAGACCGAGAGCGGCAGTGGC
AGTGGCGCCGGCAGTGGCGCCGGCAAAGCGGGCGATGGCGGCACTCGTCGGAACCAGGGCGTGCGGCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62