GenePrediction:GLEAN_5411 Details

Name: GLEAN_5411
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:851296..850753 (- strand)
Length: 544
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:851296..851228 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_132:851106..850753 (- strand)
Length: 354
>GLEAN_5411 class=GenePrediction position=GCSC_132:851296..850753 (- strand)
ATGCACAACATAGACACGGGCCTTATTACACAGCCTCAAGACCCCTATCCGCGCCTCCGCTTTACCCTGGTAGGTCCCAT
CGTCCCCTATGACTTCGGCGGCTTTGTGCAATTCCAGAGTGCCATGTATTTCCGCTGGAGTCTATAGCTAGTGTCAGCTC
TGAGGGCCGAGCTCATTATCTCCAATTTAGGCTCTTCTTCGGCTTGCTGGCCGAGTTCCTACGGGACGAGACTTTCAAAC
CGGCGACTTTGTTGCTCCGGCAGAAAGCCTCGAGGAGGATCCACGCCTTTCGCTACCAAACCTGGAGACATGGCCACTGT
GTGAGAAGGGCCGTCTCCGGTCGATGCGCCTCTTGATAGAAGCGCTAGATCTTGTTTCATTCTATCCTGCGGGCGAGACC
GTTCTCACCGTCCGCGTGCTTGTCAGAGACCTGAGTGTGACCACGTCAACCGGAGCGGCTCGCGGCGAAGAGAGAGAAAA
CGGCGATACCATGGCCGCCGTGGGACTCTGTCTTTCTCCGAAGCCGTATGAAGGCCGGGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62