GenePrediction:GLEAN_5414 Details

Name: GLEAN_5414
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:843761..842144 (- strand)
Length: 1618
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:843761..843579 (- strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_132:843471..843436 (- strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_132:843365..843284 (- strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_132:843217..842597 (- strand)
Length: 621
Type: CDS
Source: GLEAN
Position: GCSC_132:842460..842144 (- strand)
Length: 317
>GLEAN_5414 class=GenePrediction position=GCSC_132:843761..842144 (- strand)
ATGGCAGGACGTCCACCACCACCAAGAGGCAACGGCAGCGCGTATGCTCCGAACCCTGCCTCTCGCACAAACGAATACTT
TGTACCGCGCGATGGAATAGACCGAGAAGTCATCACCGCCGACATCTGTCGGTATCTAGGAAACGATGCTCTCGTCCGGC
CGGGGAACTACACCAACCCTGACGTGCGTCTTCCCTTGCCGCTCTCCGGAGATCCATGCTGCATGCTTGTCTGGCGACCC
TTTTTCATTCTTCCCAATCTAACAGCTTGAAGACAAACCAAGCAACGCAGGGGTACTATATCACTGCGTACCGTAACTTG
ACATCGGTAAGCGCTCGCTGACACACCGACTTTCCGACATTCCACGGCTCCAGCTAACCACGTTCCGATTCTCCAGGCGA
TGATTACCGATCTGAAGAACGATTCTGCTCGGTGGGAAGCAGAACGACGGAGGCAGTCGGGCTCGGGTGCAGTTGCAGGT
ACACCAGCAATCTCCTTTCGAGACTGGGCTGATAGCCATGCGCGAAGACCTAACCCTTCACCAGTCCGATACCAGGATTC
ACATATCAGAGACGGCCCCCAGCGGGCTGTTGGCGGAAACGTTGGCCACGGCGTGCCAGCGTACGGTGGACCTCCCCGGG
AGTATGACAACGGGCCTCGCTATCCCGAGGGCGACGGTCTGGGCTACAACACCGGCGCCGGCCCGGGTGCTCCTCCATAC
GGAGGCCCCGGCGGATATCCTGTTGGTTACTCACAGCCGCCGCCGCCGCCGTCGTTCCCAGCCCCCATGCACACAGGTAT
GCCGGATTCCAGGTTTGGCCCTCCAACTGGCCCAGTGCCCAGCCACGGTGGCAACTATGTCAATGCCGGCAACAACGGCG
CCATGGGCGCGCCGGAAGGTTACTCCGTTGGCTCTTACTACCAGGCAAGCTCCAGCCGGGACGTATATTCGCAGGACATG
GCCATGGACGATGTTTCCAACGTACCCATCAGGCGGACTTCTCCCAACAGCAATCCCGGTTTCGGTGGCAACCCGGGGAC
CAACTTCCGCAGGCCGTTTCCCAACGTTCCTGGAGGTGCTGGCGGCAACTACGGAGCCTATCCGCCCCCACCCAACGGTC
ACGGTGTAGCTTTCGCTCAGCCGGTTGACAACAACTACGGACGAGGTAGGATCATGGCACAATTCTTATAACTCTCCCTT
TGAATTGTTGCAGCCCCTCTCTTCTCTCTTCTGCCTTCTCTCCGCTCTCTCCCGTCTTACCCCCCAACCCGTTTTCCGTC
ATCACTCGCTCACATCTTTAGCACCCAACATGCCAACCCAGGGTTTTAGCAACCCCCACGACTTCCCCATACAGCAGCCG
CAACAGTATGAAGATCCTGCATATCCCTCCTCCCCCTCCCGTCCCGGATCCACGCCAAGCACAAAGACTCAACTTCCGTC
CCCTAGTGAACCGCCTACAGGACCCCGTCGTGACGGGGAACGTGCTGGAAGTGACCGCCCCGAGTATCGGGATCGTGGCA
TGTCCGAACGGGATCACCGGGATACGACTCCTCCGAACAAGGCCGGACTAGCAAACAAGCCAGGTCCACCTGGACAGCAC
CACTACCCCAGACGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62