GenePrediction:GLEAN_5415 Details

Name: GLEAN_5415
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:837581..836841 (- strand)
Length: 741
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:837581..837503 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_132:837184..836841 (- strand)
Length: 344
>GLEAN_5415 class=GenePrediction position=GCSC_132:837581..836841 (- strand)
ATGCCCAAGCCAGCGATCGCGCAGTTTGGCAGCATCATGCTCACGGGTCTGAGGCCCGACGCTGGCTCATACATACTCCG
TACGGAGTAGTACGGCGTAGTCCGTAAGAACAGGAGCCCCCTTTGTTTGATTTTTCTTTTTTTCTTCTTTCCCCTCTCGT
TTTCCCTCGGGGTTCGTCTCCCCAGCGCGGCAGGGAACAAGGATGCAGAGACGGCCGACAAGGGGGGGGACAAAGCCACA
CAGCAGTCAGGGGGCAGAGCCAAGTTATCTTGCTCGAGGTCGAGGCCCGGTCCTTGCAGGTCTTCCCACAAGCCCCAACA
GGACAGTTTGCAGGCGCGGCGCCCGAGTGGCCGTTTGTGGCCGGGACGCTAACACATACTATGTACGACGTACATAGGAG
CAGCAGGTCCAAGCCGGAAAGGGAGAGGATGGGCGGGCGAGATGGAGGAGAATGATTTCCGCCTTGGCGATGTGTCCAAG
AGAGCCGGAGCGGGCGAGCAGAGTCGTCTCCCAGCACGCCCCCCCTTTGCGTCGTACTCCGTACGCCTTTCTCCAAGCAG
CTTACGGCACGCGCTTGTTCGGGGCCACGACCCGCACGAGGCGCCCGAACAAAGAAAGCAGCAGAGGCTAAGGAGGGGAC
TAGAGATTAGGCAGAGGGAGAAAACGAGGGACGAGGACGAGGACGAGCGAGCGAGCGACGAGCAGACGAGCGGACATGCG
GCCGTGCCACATTCCCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62