GenePrediction:GLEAN_5416 Details

Name: GLEAN_5416
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:816336..814809 (- strand)
Length: 1528
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:816336..816198 (- strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_132:816149..815553 (- strand)
Length: 597
Type: CDS
Source: GLEAN
Position: GCSC_132:815503..814809 (- strand)
Length: 695
>GLEAN_5416 class=GenePrediction position=GCSC_132:816336..814809 (- strand)
ATGACGCCGGCTTTCAGGACGGCCGGCCCGCCGGTTCACAGCGTCAACCCGACGATGCGCGGCGTGGCGCTGGGCATTCC
GGTGTTTCTGGCCGGGATCGTGGGCTATGCCCTCTACTTGATTGCCAAGCACGTGTTGTGTATGTGTTGCCTCTTTTCTT
CTCTTGCTCCTCCCTACTGACCATTAGGGGACCAATTCTGGCACCAGGACGATCGGCACGGGCTCGCCATTGGGCTCATT
GTGCCCTACGTCGTGATTGCGGCGCTCATGGTGGCCAGCTACCTGCGGATTTTTATTACGGCGCGTCTAGACCCCGCCGT
CGTGCCGCTCGGCCCCGAGAGTGCGCGATACTACCACACGAAAAAGAAGGCGGCACTCGGGCGCGGAAGCGGGCGCAACC
ACGGGTGCAGCGGCGCCAAGGACGCACGAGACGAAGACAGGCACTCGAGCGGCCACGTCAAGCACGGAAGCAACAGCCCG
GTAGACCTGGAGGCGGGATTGGGTGGCACGGTTCCATACGGGTCAACGGGCGGGACCGGTGTGGATTCGGGGCAGCGGCG
GTCTCCAGAGACAGCAGACCCGCGACTGGACCCCGATAGTCCCGGGCTGGAGCTGTTCTACACCAAGGAAGCGTTTGAGT
GCGGCGCAGACGGACGGCCGCTGTGGTGCAACGCGTGTGGTACATGGAAACCGGACCGGGCACACCATTCTTCGGAGCTG
AACCGCTGCGTGCGCAAGCTGGACCACTTCTGTCCGTGGGTTGGCGGCGTGGTGTCCGAGACGAGTGAGTGATGATGGTG
GTGGTAGCTGGCTGTGCTGTGCTGACCAGACAGCCTTCAAGTTCTTTTTGCAGTTCAACGTGTACGCGACGCTTCTGTGG
GCCCTGACGATTGGCATTGGCGGCTACGCGCTCTCGCAGGGGACAGACGCCCGGATCATTGCGGCTCTGGCGCTGACGGG
TGTTCTGGGCCTGTTAGCGAGCGCGATGGCGTGCACGTGTGTGCACTTTGCGCTGACGAACCAGACGTCGGTCGAGACGC
ACCAGCGACGCGAGCGGGCGAAGCTGATGGCCGTGCACATCCGCCGTGGCGCGCCGGCCGTCGAGGGTGCCTACAACGTG
GTGACGTACCCGCTGCCAAAGGAGGGAGAGCAGGTCGGACAGGGGCTGGACGAGGTGGACCATCCCCAGGACCCAGACCC
CTTTGCTGTGGCACGTGCAGCCAGGGCGGCGGCGAGACGGGCTGCTGCTCGTGACCAGCTGGCGTTTCGCACGTTTGCCA
TTGTGGCCGTGCCTCGCGGCATGAACGTCTGGGACCTCGGCTGGTGCGCCAACTGGACGGCGGTCATGGGGGCCAGCCCG
CTGGACTGGCTGCTGCCGCTGCGGCAGTCGCCCTGCTGCACGAGCGACCGCGACATGCTGGCCCAGCACGGCTTCTACCG
GCTCAGCCCGGCGTTCCGGAAGCTTTGCGCGCAGTACAGCCTGCCACCGAGCACGGGGATGGAGGAGTGGGGGGGAGAGG
CTGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62