GenePrediction:GLEAN_5417 Details

Name: GLEAN_5417
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:814293..812950 (- strand)
Length: 1344
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:814293..813743 (- strand)
Length: 551
Type: CDS
Source: GLEAN
Position: GCSC_132:813597..813114 (- strand)
Length: 484
Type: CDS
Source: GLEAN
Position: GCSC_132:813003..812950 (- strand)
Length: 54
>GLEAN_5417 class=GenePrediction position=GCSC_132:814293..812950 (- strand)
ATGAACCTCCTGTATTCGACGGTGAACACGCTGCGCGACCGGTACACGCCGGCGCGCCACACGTCGACGTTCCGCAAGAC
GGGCCAGATCACACCCGAGGAGTTTGTCGCGGCGGGCGACTATCTGGTGTACAAGTTCCCGACATGGGCGTGGGCCGACG
CCGAGCCGGCGAGCCGTCGGGTGTCGCACCTGCCACCGGGCAAGCAGTACCTGGTGACGCGCAACGTGCCGTGTCGACAC
CGGCTGAGCGACGTGGCGTACGGCGGAGACGGCGGCGGTGTCGATGGCCGGCCGACGGCGGCGGATGAGGAGGTGGTCGA
GGGCGGCGGCACGGGCGGCGACGAGGACGGCTGGCTGCGCACGGGCGGCGAGCAGCTGGAAGGTGGCCGTGTCGAGGGGG
GGGCAAGCCGGCATGGTGGTGATGGGACGCGTTCGGGGAACAGGCAGACAGACGACGACGACGACGACGACGATGACGAT
GACGACATTCCCGACATGGAGGAAGAGGACGACGACGAGGCGATCATCCCGGAAGCAGGAGACGTCAAGAGGTACGTGTG
TGTTGTGGTGTTGTGCTATCTTCGTATCTTGATCTTTCTGTCTTTCTGTCTTTCTGTCTTTTCTTTTCTTCTTCTTTTCT
TTCTTCTTTTCTTCTTTCTTCTTTCTTTTTTCTTTTCCCCCTCACTAACAATACAGCGGCCACCGCAACTACTCGCTCTA
CATCATGTACTCCCCCTTCTACGCCACTCCCCGTCTCTACCTGTCTGGCTACCGACCTGACGGCCGGCCGCTGCCGCCAC
ACCTCATGATGGACGACATCGTCGGCGACTACCAGGACAAGACCGTCACCCTCGAGGACTTTCCCTTTTTCGAAAACGGC
TCCAAGATGGCCAGCGTCCATCCCTGCAAGCACGCCCCCGTCATGAAGACGCTGCTGGACCGTGCAGACGGTGCGCTCCG
GCGCCGCCGCGAGAAGCTGGCCGTCGCCGCGCAAAAGGCAAAGGCAGCTGCTGCACAGACGACATCGACAACAACGAATT
CCGCCACAGCCTCGTCCATCGACGCCCTCGCTGACGATACCCGCCGCCTCGACCTCGCCACCACCGACAACGAGTGGGAA
GAGGTCCAGGCCGATGTCGACGACGGCGAGGTCGCCATCCGTGTCGACCAGTACCTTGTTGTCTTTCTCAAGGTCGGTCT
TTTTCTCGTTCTCCCTTTCGCTCGCTTTTTTTTTTCGTGCTCTCCCGCGCTCTTCCTCCTCTCTCTCCCTCCCTCTGCTA
ACAAGCCCAGTTCATCGCTAGCGTTACCCCTGGTATCGAACACGACTTCACCATGAGCGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62