GenePrediction:GLEAN_5418 Details

Name: GLEAN_5418
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:790394..787610 (- strand)
Length: 2785
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:790394..790256 (- strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_132:790134..789317 (- strand)
Length: 818
Type: CDS
Source: GLEAN
Position: GCSC_132:789251..789104 (- strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_132:789048..788357 (- strand)
Length: 692
Type: CDS
Source: GLEAN
Position: GCSC_132:787642..787610 (- strand)
Length: 33
>GLEAN_5418 class=GenePrediction position=GCSC_132:790394..787610 (- strand)
ATGGCGTCCTCCAAAAACAAACTAAACGTGGACTCGCCCGTCTTCACGCCCGGATCCGGCCAGTCTCCTCTGCGCAAGAC
GGCCACTCTATCAATGCAGGCTGCCGCAGCCATCCCGTTTACCCCTCGGGGCAGCAGTGGTACGTTTATGTTGGGATGCA
TCTTCTTATTGTATCGTGTCGTGGCTCATCTTGCGTGTCCTGTTTATCGTCTTGTCTTCCGATTCTGTTGTTCTGCCCCC
CCACCCAACTAACCGCTCAGCTGTCTCGACCAGCAATGCATCCTCGGCCGCTTCGCCGCGCGAGCAGCTGCGCGATCTTA
TCGCTCCCAAGGACTCTGGCCAGATGCTCTCGCGCGGCGACGTGCCGGCCTTTAACGTCGCCACGGCCCGTGAGTTTGTC
CCGCGCTCGGCCGAACGCACGCCGCCCAACTACAACGTGGCCCTGGCCAGAGAGTTTCTCCTGCGCGGCGACCGCTCGCC
CTTTAACATCGCTCAAGCTGTCGAGTTCCGCCCCGTCGCCCTCTCCTCTTCGGCTGCCTCTTCGGCTGCACCCATACACA
CCCTCCAATCGTCCCCCGAGACGACACAGCAGTCGCTCCAGTCGCAGCATACTGCTTCCACAAATGCCACTCCTGCTGCT
GCTGTCACCAACTCTACCGCCTCCCAGCCTCCGCTCCAGGCCCCGACACAGCCTGCCGCACACATGCACATTCCCACTGG
CCCGGCACAGAGCTCGCAGATCAGCATTCCCACCGGCCCGTCGCGTGGCTCGGCCAATAGCCACGCAAGCAGCGGCGTCG
ACGGTGTCAGCCACATCACCTCCGGCACCAGAGCCAACAGCGTTGCCGCTGCTGCTGCTGCTGCTGCCAGCATGGCTGGT
CTGACTATGGCCGGCCTGACCTACGGCTTGGGCCCGGGCGCCGACGCCGCTGCTGCCGCCGCCCTCTATGATTCCTACAG
CGTCGCCGGTGCTGGCGTGACCGCTTTCAACCCCTATGCTGCCGCTGCCGGGGGCGCAGGCCGTGAAGGTGCTGCGTATT
TCCAGAGCCAACCTCCCTTTGGAACCCAGCACCAGCCGGTAAGCCGAGTCTTTTTTTTCTCTATCTCTCTCTGTGTGTGT
CTGTCCTGCTGACCCACTCCCAGCTCAATGAACATCTATACTTTCCCCAAGGACCTCATCGCCAGGACCTTCTGCCACGC
CAGCGCACGGTGCATGACTTCTTCCTGCCCGAGAAGCTCCGACAGGACGTCCACATGAAGTCGAGAGCAGGGAGCCAAGC
CGCTCTGACGCGTGAGTACCACGCAAGCAGTCCTCTGCGTCTCTCAATCTCGGCTAATCAAAACAGTGTCAGTCAATGTC
GAGAGCTACCACTCGCTGACGCCGTTGGACACCAACAGCCATAAGGTGGCCGGGTCGTTTGGACGGATCACGTGGCTTTA
CAAGGCAGTGGCCAGCAAAAACGGCAAGCACTACTGTCTGCGTCGGCTGGAGAACTTCCGGGTCAGCAACGAGAACGCAC
TTCGGGCGGCACGTGACTGGCGACGGGTCAGTTGCGGCAGCGTGGTCACAGTGCACGAGGCCTTCACGACACGGGCATTT
GGCGACAGCTCGGTAGTGTTTGCGACAGACTACTACCCGCTGTCGGTGACGCTGATGCAGTACCACTTCCCGACATACGG
ACAGAACCGGCCTCGCGGCAACGTGACGATCCAGGAGACGATTCTCTGGGGCTACTTTGTGCAGATTACCAACGCGCTGC
GAGCGATTCACTCGGCCGGCCTGGCTGCACGGTCCATCGACTTGACCAAGATCATCCGCACTGGCAAGAACCGGATCCGG
CTGAGCGGCTGCGCCGTGCAGGACGTCATCAACTATGACCCGACGCGCCGCGTCTCGGACCTACAACAGGACGACTTTGT
TAAGTTTGGCGAGGTCATGCTGGCCTTGGCCATGTACACGCCACCCGGCGAGTTGAAGCAGCCGTACGCACCCATGGAGC
AGATCCCCGAGATCTACTCGCACGAGCTGAAGGAGGCCGTGGCCTGGCTCTTGGCACCGCCGCCATCGCCACCTTCACGG
CCGTCTACCGCTCAGCCGTCATCTCCACCGACAGGACCGGCATCGTTGTCGTCGCCGTCGTCGCCAGAAGCCACGGCTGC
AGCCATGACGGCCTCGACCGTATCTCCCAAGAACATTGAGGCGCTGGTGACGGGCATTGCGCCACAGATGACGCGCTTCT
TCGACATGTCGCTGCAGGAGAACGATGGGCTGATGTCGATGGTGTACCGCGAGGTGGAGAATGGACGGGTGGCGCGGATG
CTGCTGAAGCTGGGGATGATCAACGAGCGCGAGAGCTACCAGCGCGACGCGACCTGGGCCGAGCACGGGCCGCGCTATCC
GCTCAAGCTGTTTCGCGACTACGTCTTCCACCAGGTAGATGAGGGCGGTCGGCCGGTGATCGACGTGTGGCACATGCTGT
CGTGCCTCAACAAGATGGACGCCGGGTCGAGCGAGGTGGTGCGGCTGTCAAGCCGGGACGGACGCACAAACCTGTTTGTG
ACGTACAAGGAGTTGAACAAGATGGTGCAGCGGTCGTTTAACGATTTGATGCGGGCGAGCAGACGATGAGGGGGGAGGGA
GAGAAGGTGGGAGAGAATGGGATAGGGCGGGAGAAAGAGTTGGAAGAAAAGAAAGGGGAGAAAGGAGAGAAGAGAACACG
ACCAAGGAGATCATGGCCAAGGAGTCATAAAGACCAGGATCCACCAGAGCACTGCCGGACGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62