GenePrediction:GLEAN_5419 Details

Name: GLEAN_5419
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:782313..778456 (- strand)
Length: 3858
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:782313..780696 (- strand)
Length: 1618
Type: CDS
Source: GLEAN
Position: GCSC_132:780643..780261 (- strand)
Length: 383
Type: CDS
Source: GLEAN
Position: GCSC_132:780195..778456 (- strand)
Length: 1740
>GLEAN_5419 class=GenePrediction position=GCSC_132:782313..778456 (- strand)
ATGTTTTCTCTGCTCGCCTCTACCCCCATCGCCCAGATGCTGACGCGTCGAGACAGACCTCCGGCTTCAATGCCTCTCAA
GGAGGAGAGCCCCGCCGACACGGGCATTTCAGATGTTCCCGTCTTCACCGAGACCCACGAGTCGACCGCCAAGTCTACAC
CCGCCTCGACTTTCTCTAATGCCTCCCAGCCGGCCAAGCCTGAGGGCGATGAGATCGTGATGGCGCTCTCTGCGGCCGGC
GCCACCATCGCGTCTGTCACCATCCTCTCGGACGACATGCCCGCAACGCCTTTTTCCCTCGCTGCAACGTCGCGTCTCTG
CTCTCCCCAGCTGTCTGGCATCAGCGAACTCGACAAAGACGCCACCACCGACTGCGTTGCCACTGCCGATGTCGAACCGA
CCCATTTGCCCGCTGTTACCACTCCGTCCACAGACGAGCTCTCGAGCAGCAACAGCAGCAACGATGTCCCACAATCCCTC
GCCACTCCTCCCTCGCCACGGTCCTCTACTCCCGTGCATGTGGCCGGCCCAGCCGAAGCCGAAGCGATCGTCGAAGCAGA
GATGATGCCTGAGGTGTACCTGGAGCAGGAAGGCCCCATCATCGTGGAGGAAGCGTCTGCCGAACGGACAGGGCTCGTGG
AGGCCCAGGACTGCACCGCTACCGTCAGCGTCGCCGAGACCATGGATATTTCCACAAACGAGGCACCTGCCCGCCAAAGT
CACCGGTTATCAGTCCGCCAGTCATCTAGCGCAGCCGCCTCACAGCCACAGCCACAGCCGTCATCTGCGACAGAAACGAG
CCTTAGCCCTATGCAACGACCGCGGAGAGCAGTAAGGACAGCTACGAGTCCCGCTGCCAAAGCTTCCCCGAGCGCCGCAG
CAAAGCCGAAAACGTCAAATGCAAAGGCGAATGTGCAGTCTCCTGTTGAAAGGCGTGCCACCCGCCTGTCCGGCACAGCT
GTTTCCCTGCTTCCAAATCCCAGCTCAGCATCTTCGTTGGGCAAACGGGGGCGCCGTCTCGAAGCCAAAAAAGCCAACAT
CCCTCGCGAGCTTCGCCGTCTGGAAGACACAAAGGAGTTTTCCCATGTCGACGAGAAGCCGGTTGTCTACACCGTTTGGA
GCAACGGCAAGTATGTGCCCGCAAATGCAGCAGGAGAGCCGTTGATCGACAAGAAGGCCACTGATAAGACGGCCACCCTG
GGAAACAAGGCGATTTCTTCTCTCGACGATGAGGACGCAAGAGGCGACTCGCCACGCAAACGAGCCAAGCTGGGCAGACT
GGGTCCTGGCGCCGTTGGCGCAGAGGAAGACGACGACCAGCAGGGCTTCTTCAAACCGACACCAAGGCGGGTGAAGAAGT
GGCTGGACAAGGGTCTTTATGCTGGCCAGCCCGTGCCTGGCGATCCCTCAGTGGGCTTGACTGCTACCGAGAAGAAGGCA
CTGGCAACGCTTCCCGAGCTCACAAAGACGTACCCTAGGAACGAGACATTACCAATGCCAATCTTCACCGGGATGCGGCT
CCTGGTCCATGGCCGAGACTTTAAGATGCCGTTTGACGTTTTTAATCCGCTGCCACCCGGCCAGCCGAAGCCTGTCAAGT
ATGGCAGGTTCAGCAAGAGTGAGTTGGGCTGATGTAATCCGGTTGGTGCTTCGCAAAGCTGACTCTCCAGACCGATTTGT
CGGCGATGCTCACGCCATCTGGCGGAAGAACCCCGACTTTGACGACTTCTCGTCCAAGTGTGTTTGCAAGCCGGAGACGG
GCTGTGACGAGGACTGCCAGAACCGGATCATGCTTTACGAATGTGACGACATGAACTGCAACGTGGGCCCGGAGCGGTGC
CATAACCGCGAGTTTCAGCGCTTGGCCGAGCGCACCGCCTCCAAAAACCCATATCACGTTGGCGTTGAAGTTTTCAAGAC
GCCTGACCGCGGCCATGGGATTCGCGCCAGCCGGAGCTTCAAGCCAAGCCAGATCATCATGGAGTACATTGGCGAGATCA
TCACGGAGGAGGAGTCTGACCGGCGAATGAATGAGCTGTACAAGAACAATGCGGTGAGTGACGTTTGCCGCGATGAATCT
GTGCGTGGTTATGGATTTTGGCTAACCATCGTACGCAGTGCTACTATCTCATGTCCTTTGACCAGTCTCTCATCATTGAT
GGCACCAGCGGTAGTATCGCTCGTTTTGTCAATCACTCGTGCTCGCCCAACTGCCGCATGATCAAGTGGATTGTGTCTGG
ACAGCCACGGATTGCCTTGTTTGCCGGGGATCGTCCGATCATGACAGGAGAGGAGCTGACATACGACTACAACTTTGATC
CGTACTCGTCGAAAAATGTCCAGACGTGCCTCTGCGGCAGCGAGAACTGCCGTGGCATTCTGGGGCCTCGCAAACGGGAC
AAGGCGGCTACGAAGGCAGCGGCAGAAAAGGCAGCGGCCGAGAAGGCGGCGTCGGCATTGGCCAAGAGCAAGGGCGGCAA
GGGGAAGAATGCTAAGAAAGCAGGCACCATGCTAGGAAAGCGGAAATTGGATGCGTACAACAACGGCAAGGAGGAGGAGA
GTGTCGGCAGTCCGGCAGCAAAAAGGGCCAACGTCATGGTTCCTTCTAAGAGAGGACCCGGGCGGCCTCGAACTCCGGAG
AAGAAGACAAAGTCGGCTGCCAAGGTGACGACGACAAAGGCAGCACTAGCCGCGTTAGCAGCCAAAGCGACAAGGGATGC
CAGAGCAGCGAAGGCCACCAAAGTAGCAAAAGCAAAGGCAGCCGAGCCAGGCTCGGCTGTCAAGACAGCGAAAGCAGGCG
GTACAGGGAAGACGAAGAAGCCGGTGAAGACGGTCAAAGCGGCAAAGGGAGTGAAAGTCACCAAGACAGCGCGGGGCTTC
AAAGCAGCAAAGACGATCAAGACGAAGACGATGGTTACGACGACGAAGACAACGACAAAAAAGACGACGGCATCAGCGTT
GACGTTGGCAGAACCAATCGATGGCGCTGTGACACGGAAGCACAAGGCCACAGATGAAGCAGTGCCGGCAGCCAGTACAG
CAAATGGAGGAAAAGCAGGGCCCGTACGAAAGCCGAAAGGCACGAATGCGGAAGAGGATGTGAATAGTGCGGCTACGGAG
GCGGCGAATGCCGAGACAGCATTGCGGACGACTCCTATGGCGAGAGCGCTGGCAAAGGCTGCAAAGGACGCAGCCAAGGC
AGCCAAGGCGGTAGGCAAGACCAAAGCGAAACCGTCAGTCGGTAAGCGGGCGACAACAATGGCAGCAGCAGCAGCTTCGA
AGCGGGCCGACAAAGCCAAGATGCCGGCAAAGGCTGTCAAGCCGACGACAGCGAAAGTGGACAGACCAGCGGGCAAGGCA
AAGACAACGGAGCAGACATCAGGCAGGCCGTCGTCGGACGAAGCCGCAGCCGAGACTGAAACGGGCACAGAGGTGGCTGA
GACGGCCAAAGAAGGCGGCCCTCCAAAGCTGGTGCAACAGAAACTAGACTTTCCTACGATAGGATCTTCGCCCCGGCGAA
AGCCCGGACGACCGCCATCTGCAAAGACGCTGAAGGCGAAGAGCATGGGCGCAGGGATAGGCACAGTGAGGCCGCAGGTT
GGCGAGGTGTCCGGGCCAGTCAATGTGAAGAGGCCGGTTGGACGGCCACGAGGATCGAAGAAGGCCGTGAAGCCACAGCA
GGCGCTGCGGCCGACATCACCATCGCTGCCGTCTCCGGCCAGCAACAAGGAGACGGAGCAGGGCGAAAAGGTTGGCGCGA
CCGGCAGCGAGATTATGCAGGAGGTGTCTGATGTGGTTCAGGGGACTGCAGAAGACGTTATCCACGTTGCTTCTAGTGTC
TTCAATGCTGCGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62